LIFE BEYOND 3: In Search of Giants. The Hunt for Intelligent Alien Lif...

0:00

capionist be welcome to help this video translate to other language have a nice day, here's the whole scripts in Google docs: bit.ly/3ztdfQ5 ‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎‎ ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ ‏‏‎ ‎ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ‏‏‎ ‎ ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ᶠᵒˡˡᵒʷ ʸᵒᵘʳ ᶜᵘʳⁱᵒᵘˢˡʸ ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ᶠᵒˡˡᵒʷ ʸᵒᵘʳ ᶜᵘʳⁱᵒᵘˢˡʸ ˡᵉᵃᵈ ʰᵘᵐᵃⁿᶦᵗʸ ᶠᵒʳʷᵃʳᵈ

0:07

ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ ‏‏‎ ‎ ᶠᵒˡˡᵒʷ ʸᵒᵘʳ ᶜᵘʳⁱᵒᵘˢˡʸ ˡᵉᵃᵈ ʰᵘᵐᵃⁿᶦᵗʸ ᶠᵒʳʷᵃʳᵈ ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ 𝔄𝔫𝔶 𝔰𝔲𝔣𝔣𝔦𝔠𝔦𝔢𝔫𝔱𝔩𝔶 𝔞𝔡𝔳𝔞𝔫𝔠𝔢𝔡 𝔱𝔢𝔠𝔥𝔫𝔬𝔩𝔬𝔤𝔶 ‏‏‎ ‎ ‏‏‎ ‎ 𝔄𝔫𝔶 𝔰𝔲𝔣𝔣𝔦𝔠𝔦𝔢𝔫𝔱𝔩𝔶 𝔞𝔡𝔳𝔞𝔫𝔠𝔢𝔡 𝔱𝔢𝔠𝔥𝔫𝔬𝔩𝔬𝔤𝔶 𝔦𝔰 𝔦𝔫𝔡𝔦𝔰𝔱𝔦𝔫𝔤𝔲𝔦𝔰𝔥𝔞𝔟𝔩𝔢 𝔣𝔯𝔬𝔪 𝔪𝔞𝔤𝔦𝔠. ‏‏‎ ‎

0:14

𝔄𝔫𝔶 𝔰𝔲𝔣𝔣𝔦𝔠𝔦𝔢𝔫𝔱𝔩𝔶 𝔞𝔡𝔳𝔞𝔫𝔠𝔢𝔡 𝔱𝔢𝔠𝔥𝔫𝔬𝔩𝔬𝔤𝔶 𝔦𝔰 𝔦𝔫𝔡𝔦𝔰𝔱𝔦𝔫𝔤𝔲𝔦𝔰𝔥𝔞𝔟𝔩𝔢 𝔣𝔯𝔬𝔪 𝔪𝔞𝔤𝔦𝔠. 𝐀𝐑𝐓𝐇𝐔𝐑 𝐂. 𝐂𝐋𝐀𝐑𝐊𝐄

0:20

𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, ‏‏‎ ‎ 𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗲𝘃𝗲𝗻 𝗮 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲 𝘄𝗼𝘂𝗹𝗱 𝗯𝗲 𝗵𝗶𝘀𝘁𝗼𝗿𝗶𝗰. 𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, ‏‏‎ ‎ 𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗲𝘃𝗲𝗻 𝗮 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲 𝘄𝗼𝘂𝗹𝗱 𝗯𝗲 𝗵𝗶𝘀𝘁𝗼𝗿𝗶𝗰. 𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, ‏‏‎ ‎ 𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗲𝘃𝗲𝗻 𝗮 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲 𝘄𝗼𝘂𝗹𝗱 𝗯𝗲 𝗵𝗶𝘀𝘁𝗼𝗿𝗶𝗰.

0:32

𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗲𝘃𝗲𝗻 𝗮 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲 𝘄𝗼𝘂𝗹𝗱 𝗯𝗲 𝗵𝗶𝘀𝘁𝗼𝗿𝗶𝗰. 𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗲𝘃𝗲𝗻 𝗮 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲 𝘄𝗼𝘂𝗹𝗱 𝗯𝗲 𝗵𝗶𝘀𝘁𝗼𝗿𝗶𝗰. 𝗜𝗻 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗮𝗹𝗶𝗲𝗻 𝗹𝗶𝗳𝗲, 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗲𝘃𝗲𝗻 𝗮 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲 𝘄𝗼𝘂𝗹𝗱 𝗯𝗲 𝗵𝗶𝘀𝘁𝗼𝗿𝗶𝗰. 𝗕𝘂𝘁 𝘄𝗲'𝗿𝗲 𝗻𝗼𝘁 𝗷𝘂𝘀𝘁 𝗹𝗼𝗼𝗸𝗶𝗻𝗴 𝗳𝗼𝗿 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲𝘀. 𝗕𝘂𝘁 𝘄𝗲'𝗿𝗲 𝗻𝗼𝘁 𝗷𝘂𝘀𝘁 𝗹𝗼𝗼𝗸𝗶𝗻𝗴 𝗳𝗼𝗿 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲𝘀. 𝗕𝘂𝘁 𝘄𝗲'𝗿𝗲 𝗻𝗼𝘁 𝗷𝘂𝘀𝘁 𝗹𝗼𝗼𝗸𝗶𝗻𝗴 𝗳𝗼𝗿 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲𝘀.

0:39

𝗕𝘂𝘁 𝘄𝗲'𝗿𝗲 𝗻𝗼𝘁 𝗷𝘂𝘀𝘁 𝗹𝗼𝗼𝗸𝗶𝗻𝗴 𝗳𝗼𝗿 𝘁𝗶𝗻𝘆 𝗺𝗶𝗰𝗿𝗼𝗯𝗲𝘀. 𝗪𝗲'𝗿𝗲 𝗼𝗻 𝗮 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗴𝗶𝗮𝗻𝘁𝘀.

0:46

𝗪𝗲'𝗿𝗲 𝗼𝗻 𝗮 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗴𝗶𝗮𝗻𝘁𝘀. 𝗪𝗲'𝗿𝗲 𝗼𝗻 𝗮 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗴𝗶𝗮𝗻𝘁𝘀. 𝗪𝗲'𝗿𝗲 𝗼𝗻 𝗮 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗴𝗶𝗮𝗻𝘁𝘀. 𝗪𝗲'𝗿𝗲 𝗼𝗻 𝗮 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗴𝗶𝗮𝗻𝘁𝘀.

0:56

𝗔𝗿𝗲 𝘁𝗵𝗲𝘆 𝗼𝘂𝘁 𝘁𝗵𝗲𝗿𝗲?

1:09

𝗪𝗶𝗹𝗹 𝘄𝗲 𝗲𝘃𝗲𝗿 𝗺𝗮𝗸𝗲 𝗰𝗼𝗻𝘁𝗮𝗰𝘁? 𝗪𝗶𝗹𝗹 𝘄𝗲 𝗲𝘃𝗲𝗿 𝗺𝗮𝗸𝗲 𝗰𝗼𝗻𝘁𝗮𝗰𝘁? 𝗪𝗶𝗹𝗹 𝘄𝗲 𝗲𝘃𝗲𝗿 𝗺𝗮𝗸𝗲 𝗰𝗼𝗻𝘁𝗮𝗰𝘁? 𝗪𝗶𝗹𝗹 𝘄𝗲 𝗲𝘃𝗲𝗿 𝗺𝗮𝗸𝗲 𝗰𝗼𝗻𝘁𝗮𝗰𝘁?

1:16

𝗛𝗼𝘄 𝗽𝗼𝘄𝗲𝗿𝗳𝘂𝗹 𝗰𝗼𝘂𝗹𝗱 𝘁𝗵𝗲𝘆 𝗯𝗲? 𝗛𝗼𝘄 𝗽𝗼𝘄𝗲𝗿𝗳𝘂𝗹 𝗰𝗼𝘂𝗹𝗱 𝘁𝗵𝗲𝘆 𝗯𝗲? 𝗛𝗼𝘄 𝗽𝗼𝘄𝗲𝗿𝗳𝘂𝗹 𝗰𝗼𝘂𝗹𝗱 𝘁𝗵𝗲𝘆 𝗯𝗲? 𝗛𝗼𝘄 𝗽𝗼𝘄𝗲𝗿𝗳𝘂𝗹 𝗰𝗼𝘂𝗹𝗱 𝘁𝗵𝗲𝘆 𝗯𝗲? 𝗛𝗼𝘄 𝗽𝗼𝘄𝗲𝗿𝗳𝘂𝗹 𝗰𝗼𝘂𝗹𝗱 𝘁𝗵𝗲𝘆 𝗯𝗲? 𝗛𝗼𝘄 𝗽𝗼𝘄𝗲𝗿𝗳𝘂𝗹 𝗰𝗼𝘂𝗹𝗱 𝘁𝗵𝗲𝘆 𝗯𝗲? 𝗛𝗼𝘄 𝗽𝗼𝘄𝗲𝗿𝗳𝘂𝗹 𝗰𝗼𝘂𝗹𝗱 𝘁𝗵𝗲𝘆 𝗯𝗲? 𝗛𝗼𝘄 𝗽𝗼𝘄𝗲𝗿𝗳𝘂𝗹 𝗰𝗼𝘂𝗹𝗱 𝘁𝗵𝗲𝘆 𝗯𝗲?

1:40

𝗔𝗳𝘁𝗲𝗿 𝟲𝟬 𝘆𝗲𝗮𝗿𝘀 𝗼𝗳 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴, ‏‏‎ ‎ 𝗔𝗳𝘁𝗲𝗿 𝟲𝟬 𝘆𝗲𝗮𝗿𝘀 𝗼𝗳 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴, 𝘁𝗵𝗲 𝗴𝗮𝗺𝗲 𝗶𝘀 𝗮𝗯𝗼𝘂𝘁 𝘁𝗼 𝗰𝗵𝗮𝗻𝗴𝗲. 𝗔𝗳𝘁𝗲𝗿 𝟲𝟬 𝘆𝗲𝗮𝗿𝘀 𝗼𝗳 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴, 𝘁𝗵𝗲 𝗴𝗮𝗺𝗲 𝗶𝘀 𝗮𝗯𝗼𝘂𝘁 𝘁𝗼 𝗰𝗵𝗮𝗻𝗴𝗲. 𝗔𝗳𝘁𝗲𝗿 𝟲𝟬 𝘆𝗲𝗮𝗿𝘀 𝗼𝗳 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴, 𝘁𝗵𝗲 𝗴𝗮𝗺𝗲 𝗶𝘀 𝗮𝗯𝗼𝘂𝘁 𝘁𝗼 𝗰𝗵𝗮𝗻𝗴𝗲. 𝗔𝗳𝘁𝗲𝗿 𝟲𝟬 𝘆𝗲𝗮𝗿𝘀 𝗼𝗳 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴, 𝘁𝗵𝗲 𝗴𝗮𝗺𝗲 𝗶𝘀 𝗮𝗯𝗼𝘂𝘁 𝘁𝗼 𝗰𝗵𝗮𝗻𝗴𝗲.

1:50

𝗡𝗲𝘄 𝗿𝗲𝘀𝗲𝗮𝗿𝗰𝗵 𝗶𝘀 𝗿𝗲𝘃𝗲𝗮𝗹𝗶𝗻𝗴 𝘀𝘁𝘂𝗻𝗻𝗶𝗻𝗴 𝗽𝗼𝘀𝘀𝗶𝗯𝗶𝗹𝗶𝘁𝗶𝗲𝘀. 𝗡𝗲𝘄 𝗿𝗲𝘀𝗲𝗮𝗿𝗰𝗵 𝗶𝘀 𝗿𝗲𝘃𝗲𝗮𝗹𝗶𝗻𝗴 𝘀𝘁𝘂𝗻𝗻𝗶𝗻𝗴 𝗽𝗼𝘀𝘀𝗶𝗯𝗶𝗹𝗶𝘁𝗶𝗲𝘀. 𝗡𝗲𝘄 𝗿𝗲𝘀𝗲𝗮𝗿𝗰𝗵 𝗶𝘀 𝗿𝗲𝘃𝗲𝗮𝗹𝗶𝗻𝗴 𝘀𝘁𝘂𝗻𝗻𝗶𝗻𝗴 𝗽𝗼𝘀𝘀𝗶𝗯𝗶𝗹𝗶𝘁𝗶𝗲𝘀. 𝗡𝗲𝘄 𝗿𝗲𝘀𝗲𝗮𝗿𝗰𝗵 𝗶𝘀 𝗿𝗲𝘃𝗲𝗮𝗹𝗶𝗻𝗴 𝘀𝘁𝘂𝗻𝗻𝗶𝗻𝗴 𝗽𝗼𝘀𝘀𝗶𝗯𝗶𝗹𝗶𝘁𝗶𝗲𝘀.

1:56

𝗙𝗿𝗼𝗺 𝘁𝗵𝗲 𝗽𝗹𝗮𝗻𝗲𝘁𝗮𝗿𝘆 𝘁𝗼 𝘁𝗵𝗲 𝗴𝗮𝗹𝗮𝗰𝘁𝗶𝗰

2:01

𝘁𝗼 𝘁𝗵𝗲 𝗴𝗮𝗹𝗮𝗰𝘁𝗶𝗰 𝘁𝗼 𝘁𝗵𝗲 𝗴𝗮𝗹𝗮𝗰𝘁𝗶𝗰

2:08

𝗮𝗻𝗱 𝗯𝗲𝘆𝗼𝗻𝗱. 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀

2:15

𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 𝗽𝗿𝗲𝘀𝗲𝗻𝘁𝘀

2:22

L‏‏‎ ‎I‏‏‎ ‎F‏‏‎ ‎E‏‏‎ ‎ L‏‏‎ ‎I‏‏‎ ‎F‏‏‎ ‎E‏‏‎‏‏‎ ‎‏‏‎‎ ‎ B‏‏‎ ‎E‏‏‎ ‎Y‏‏‎ ‎O‏‏‎ ‎N‏‏‎ ‎D

2:30

𝐂𝐇𝐀𝐏𝐓𝐄𝐑 𝐈𝐈𝐈 ‏‏‎ ‎ 𝐂𝐇𝐀𝐏𝐓𝐄𝐑 𝐈𝐈𝐈 ɪ‏‏‎ɴ ꜱ‎ᴇ‏‏‎ᴀ‏‏‎‎ʀ‏‏ᴄ‏‏ʜ‏‏‎ ᴏ‏‏‎ꜰ‏‏‎ ɢ‏‏‎‎ɪ‏‏‎ᴀ‏‏‎ɴ‎ᴛ‎ꜱ

2:43

[] [ ] [‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] [‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] [] [‏‏‎ ‎0‏‏‎ ] [] [ ‎0‏‏‎ ] [ ] [‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] [‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] [‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] [‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] ‏‏‎ ‎ [‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] The most [‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] ‏‏‎ ‎ [‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] common complex object known- [‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] ..known in the universe [‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] ..known in the universe [‏‏‎ ‎0‏‏‎ ‎‎] [‏‏‎ ‎1‏‏‎ ‎‎] ..known in the universe [‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] [‏‏‎ ‎1‏‏‎ ‎‎] ..known in the universe [‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] [‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] ..known in the universe [‏‏‎ ‎] [‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎] ..known in the universe [‏‏‎ ‎] [‏‏‎ ‎] ..known in the universe [‏‏‎‎] [‏‏‎ ‎] ..known in the universe [‏‏‎‎] [‏‏‎‎] ‏‏‎‎..known in the universe [‏‏‎‎] ‏‏‎‎..known in the universe ‏‏‎‎..known in the universe ‏‏‎‎..known in the universe ‏‏‎ ‎ ..known in the universe - is the Human brain.

2:53

These.. 86 86,000,000,000 86,000,000,000 neurons have given us have given us the power to transform.. to transform our planet.

3:02

But is this- ..this the best nature this the best nature can do? We now know..

3:08

We now know.. 1 ‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‏‏‎ ‎‎‏‏‎ ‎‏‏‎ ‎1 there're something like 10 there're something like 10, there're something like 10,0 there're something like 10,00 there're something like 10,000 there're something like 10,000, there're something like 10,000,0 there're something like 10,000,00 there're something like 10,000,000 there're something like 10,000,000, there're something like 10,000,000,0 there're something like 10,000,000,00 there're something like 10,000,000,000 there're something like 10,000,000,000, there're something like 10,000,000,000,0 there're something like 10,000,000,000,00 there're something like 10,000,000,000,000 there're something like 10,000,000,000,000, there're something like 10,000,000,000,000,0 ..something like 10,000,000,000,000,00 ..something like 10,000,000,000,000,000 ..something like 10,000,000,000,000,000, ..something like 10,000,000,000,000,000,0 ..something like 10,000,000,000,000,000,00 ..something like 10,000,000,000,000,000,000 ..something like 10,000,000,000,000,000,000, ..something like 10,000,000,000,000,000,000,0 ‏‏‎ ‎ ..something like 10,000,000,000,000,000,000,00 ‏‏‎ ‎ ..something like 10,000,000,000,000,000,000,000 ‏‏‎ ‎ ..something like 10,000,000,000,000,000,000,000 ‏‏‎ ‎ ..something like 10,000,000,000,000,000,000,000 habitable planets ..something like 10,000,000,000,000,000,000,000 (sextillion) habitable planets ..something like 10,000,000,000,000,000,000,000 (sextillion) habitable planets in the universe.

3:15

10 billion-trillion (sextillion).. 10 billion-trillion (sextillion) chances for the brain, to be eclipsed to be eclipsed by to be eclipsed by something else.

3:28

The search for intelligent life.. is more is more than just a is more than just a scientific is more than just a scientific curiosity.

3:35

Is driven Is driven by a deep desire.. to connect to connect with something to connect with something greater.

3:42

Finding an Alien civilization.. wouldn't wouldn't just reveal, we're not alone;

3:51

it could chart a new course a new course of evolution for our species.

3:57

And unlike primitive life, Alien intelligence.. could be detectable thousands thousands of light-years

4:03

thousands of light-years away, making them making them potentially easier to find.

4:12

What do they know that we don't?

4:18

And how And how do we make contact?

4:23

We're not.. We're not the first We're not the first to wonder...

4:30

‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‏‏‎ ‎ 𝗜. ‏ ‏‏‎ ‎‏‎

4:35

𝗜. 𝗠𝗘𝗦𝗦𝗘𝗡𝗚𝗘𝗥𝗦 ‏‏‎ ‎ 𝗜. 𝗠𝗘𝗦𝗦𝗘𝗡𝗚𝗘𝗥𝗦 ʳᵉᵛᵉᵃˡᶦⁿᵍ ʷᵉ'ʳᵉ ⁿᵒᵗ ᵃˡᵒⁿᵉ

4:41

2 200 200 years ago we dreamed of lighting- ..lighting huge rings of fire in the Sahara Desert

4:47

to signal to signal our presence. And in the And in the 18

4:52

And in the 1860s, a French poet- ..poet proposed proposed a patchwork of of giant of giant mirrors,

4:58

reflecting reflecting sunlight reflecting sunlight to Mars.. in the form of The of The Big Dipper.

5:04

But if you want to send a signal.. across an Ocean an Ocean of space an Ocean of space ‏‏‎ ‎ an Ocean of space - ‏‏‎ ‎ an Ocean of space - Bonfires Bonfires and and reflected-sunlight

5:10

won't help you much. Even Even a nuclear war

5:16

on a on a nearby on a nearby planet, would be.. would be virtually be virtually impossible- ..impossible to detect with current technology.

5:31

To really To really get your message To really get your message across, you need a form a form of light you can't even see

5:40

- Radio-waves are ideal.. ideal for carrying information long distance, because compared

5:45

to other to other forms of light, they travel.. travel more freely through interstellar-gas and dust.

5:52

That's why That's why SETI That's why SETI ‏‏‎ ‎ That's why SETI - The Search for Extraterrestrial Intelligence, - The Search for Extraterrestrial Intelligence, has focused has focused almost..

5:57

entirely on scanning for radio signals, whether whether intentional messages,

6:02

or or byproducts.. byproducts of technology.

6:14

Our own radio-transmissions have now traveled.. 1 100 light-years and reached..

6:19

reached 7 reached 75 reached 75 star systems, some of which include include potentially include potentially habitable planets.

6:27

And if Alien intelligence Alien intelligence Lies Beyond- ..Beyond this Bubble of signals, they could could still infer life

6:33

on Earth by by spotting Oxygen in our atmosphere.

6:41

Thanks Thanks to the SETI Institute, and the.. and the recent 'Breakthrough.. 'Breakthrough Listen' project. We have now

6:46

scanned, scanned, tens scanned, tens of millions- ..tens of millions of stars for signals.

6:53

But despite despite all this after after 6-decades after 6-decades of searching after 6-decades of searching..

6:59

after 6-decades of searching‏‏‎ ‎‏‏‎ ‎ after 6-decades of searching - Nothing ,only ,only a series of..

7:05

of false alarms and and dead-end leads

7:10

,we call it - The - The Great - The Great Silence

7:17

But But in reality.. the search the search has barely barely even begun.

7:22

There are There are 2 There are 2,000,000,000,000 2,000,000,000,000 other galaxies out there that that are still that are still too far away

7:27

for practical study. If space or the size

7:33

of all Earths-oceans, we would've we would've searched searched less than.. less than a Pools-worth of Water

7:39

for signs- for signs of intelligent life.

7:46

On top On top of this, we might even be looking.. for the for the wrong for the wrong thing.

7:57

There's more than one-way to to communicate to communicate across to communicate across space.

8:03

In Alien life might view might view radio- as primitive technology.

8:14

We have to We have to consider every.. every possible alternative. From the.. From the Practical

8:21

to the.. to the Unimaginable.

8:29

The search is now is now underway.. for a ..different ..different type ..different type of signal.

8:34

One we could even spot with the with the naked eye with the naked eye ‏‏‎ ‎ with the naked eye - ‏‏‎ ‎

8:40

with the naked eye - Laser light with the naked eye - Laser light,

8:45

[] [ ‏‎] [ ‏ ‏ ‏] [ ‏‎2‏‏‎ ‏‎‎] [ ‏‎2‏‏‎ ‏‎‎] [ ‏‎2‏‏‎ ‏‎‎] ‏‏‎ ‎ [ ‏‎2‏‏‎ ‏‎‎] high-powered laser bursts [ ‏‎2‏‏‎ ‏‎‎] ‏‏‎ ‎ [ ‏‎2‏‏‎ ‏‎‎] can outshine [ ‏‎2‏‏‎ ‏‎‎] can outshine [ ‏ ‏ ‏] can outshine [ ‏‎] can outshine [‏‏‎‏‏‎‏‏‎] ..a star by by thousands

8:51

by thousands of times. And can carry- ..carry far more carry far more DPS carry far more DPS than radio

9:07

We would.. We would have to be in direct-line of sight, to detect to detect the beam.

9:13

But spread across across many light-years, they would widen widen to encompass.. entire planets and moons.

9:25

Fleets of laser beacons could be used- ..used to sweep sweep the entire galaxy.

9:31

Like Alien Lighthouses, in a Cosmic Sea.

9:40

Thanks.. Thanks to a recent recent crowdfunding effort, plans are now now in motion to monitor the

9:46

the entire the entire night sky for laser pulses.

9:55

But while But while these But while these bright flashes would be would be relatively easy to find, advanced life

10:00

might be using- ..using something ..using something far more elusive ..using something far more elusive ‏‏‎ ‎

10:06

..using something far more elusive - Neutrinos, tiny tiny subatomic particles

10:11

that are streaming through you, by the the trillions every second.

10:17

These ghosts particles, can pass through pass through entire planets, and not and not touch

10:22

and not touch a single and not touch a single atom. It takes It takes a giant room.. 𝐒 ᴍ ‏‏‎ ‎ 𝐒𝐔 ᴍᴏ ‏‏‎ ‎ 𝐒𝐔𝐏 ᴍᴏᴜ ‏‏‎ ‎ 𝐒𝐔𝐏𝐄 ᴍᴏᴜɴ ‏‏‎ ‎ 𝐒𝐔𝐏𝐄𝐑 ᴍᴏᴜɴᴛ like this, 𝐒𝐔𝐏𝐄𝐑- ᴍᴏᴜɴᴛ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊 ᴍᴏᴜɴᴛ ɪ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊 ᴍᴏᴜɴᴛ ɪ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀 ᴍᴏᴜɴᴛ ɪᴋ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌 ᴍᴏᴜɴᴛ ɪᴋᴇ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈 ᴍᴏᴜɴᴛ ɪᴋᴇɴ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ like this,

10:27

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ like this, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ ‏‏‎ ‎ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ ‏‏‎ ‎ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ ‏‏‎ ‎ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ to detect 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ just a 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ just a handful of them, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ just a handful of them, per day. 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎𝐑 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀɴ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓𝐎 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘᴀ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂𝐓 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀᴘ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄𝐂 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊᴀ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, ᴊ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄𝐓 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ, 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 𝐃 ᴍᴏᴜɴᴛ ɪᴋᴇɴᴏ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇɴ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃𝐄 ᴍᴏᴜɴᴛ ɪᴋᴇ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍𝐃 ᴍᴏᴜɴᴛ ɪᴋ

10:32

𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀𝐍 ᴍᴏᴜɴᴛ ɪ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊𝐀 ᴍᴏᴜɴᴛ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎𝐊 ᴍᴏᴜɴᴛ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈𝐎 ᴍᴏᴜɴ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌𝐈 ᴍᴏᴜ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀𝐌 ᴍᴏ 𝐒𝐔𝐏𝐄𝐑-𝐊𝐀 ᴍ 𝐒𝐔𝐏𝐄𝐑-𝐊 𝐒𝐔𝐏𝐄𝐑- 𝐒𝐔𝐏𝐄𝐑 𝐒𝐔𝐏𝐄 𝐒𝐔𝐏 𝐒𝐔 𝐒 But researchers researchers recently proved.. neutrino communication. neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁ Department of Electrical and Computer Engineering, North Carolina State University, Raleigh, NC 27695 - D.D. Stancil₁ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁ Department of Electrical and Computer Engineering, North Carolina State University, Raleigh, NC 27695 - B.L. Hughes₁ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁ Department of Electrical and Computer Engineering, North Carolina State University, Raleigh, NC 27695 - B.L. Hughes₁ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - P. Adamson₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - M. Andrews₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - L. Bagby₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - D. Boehnlein₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - D.P. Capista₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - T. Griffin₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - E. Hahn₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - D.A. Harris₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - K. Kephart₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - J. Kilmer₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - K.S. McFarland₅'₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - J.G. Morffin₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - J. Osta₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - A. Pla-Dalmau₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - P. Rubinov₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - D.W. Schmitz₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - R. Stefanski₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂ Fermi National Accelerator Laboratory, Batavia, IL 60510 - J. Voirin₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₃ Universidad Nacional de Ingenieria, Av. Tupac Amaru 210. Lima. Peru - M. Alania₃ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₃ Universidad Nacional de Ingenieria, Av. Tupac Amaru 210. Lima. Peru - A. Chamorro₃ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₃ Universidad Nacional de Ingenieria, Av. Tupac Amaru 210. Lima. Peru - K. Hurtado₃ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - L. Aliaga₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - C. Araujo Del Castillo₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - J.L. Bazo Alba₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - A.M. Gago₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - N. Ochoa₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - C.E. Pérez Lara₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₄ Sección Fisica, Departamento de Ciencias, Pontificia Univerndad Católica del Peru, Apartado 1761. Lima Peru - J.P Velàsquez₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - A. Bodek₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - R. Bradford₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - H. Budd₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J.Chvojka₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - P.D Conrow₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - M. Day₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J. Griffin₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - C.M. Hoffman₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - A. Judd₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - H. Lee₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - L. Loiacono₅'₁₉ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - S.Manly₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - C.M. Marshall₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - K.S. McFarland₅'₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - A. Mislivec₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - A. M. McGowan₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J.A. Niemiee-Gielata₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J.S. Paradis₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J. Park₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - G. Perdue₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - D. Ruggiero₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₅ Department of Physics and Astronomy, University of Rochester, Rochester NY 14627 - J. Wolcott₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₆ Departamento de Fisica, Universidad Técnica Federico Santa María, Avda. España 1680 Casilla 110-V Valparaíco, Chile - W.K. Brooks ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₆ Departamento de Fisica, Universidad Técnica Federico Santa María, Avda. España 1680 Casilla 110-V Valparaíco, Chile - G. Maggi₆ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₆ Departamento de Fisica, Universidad Técnica Federico Santa María, Avda. España 1680 Casilla 110-V Valparaíco, Chile - C. Peña₆ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₆ Departamento de Fisica, Universidad Técnica Federico Santa María, Avda. España 1680 Casilla 110-V Valparaíco, Chile - F. Prokoshin₆ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₆ Departamento de Fisica, Universidad Técnica Federico Santa María, Avda. España 1680 Casilla 110-V Valparaíco, Chile - F. Prokoshin₆ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₇ Institute for Nuclear Research of the Russian Academy of Sciences, 117312 Moscow, Russia - A. Butkevich₇ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₇ Institute for Nuclear Research of the Russian Academy of Sciences, 117312 Moscow, Russia - S.A. Kulagin₇ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₇ Institute for Nuclear Research of the Russian Academy of Sciences, 117312 Moscow, Russia - S.A. Kulagin₇ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₈ Centro Brasileiro de Pesquisas Flsicas, Rua Dr. Xavier Sigaud 150, Urca, Rio de Janeiro, RJ, 22190-180, Brazil - D.A.M. Caicedo₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₈ Centro Brasileiro de Pesquisas Flsicas, Rua Dr. Xavier Sigaud 150, Urca, Rio de Janeiro, RJ, 22190-180, Brazil - C.M. Castromonte₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₈ Centro Brasileiro de Pesquisas Flsicas, Rua Dr. Xavier Sigaud 150, Urca, Rio de Janeiro, RJ, 22190-180, Brazil - G.A. Fiorentini₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₈ Centro Brasileiro de Pesquisas Flsicas, Rua Dr. Xavier Sigaud 150, Urca, Rio de Janeiro, RJ, 22190-180, Brazil - H. da Motta₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₈ Centro Brasileiro de Pesquisas Flsicas, Rua Dr. Xavier Sigaud 150, Urca, Rio de Janeiro, RJ, 22190-180, Brazil - J.L. Palomino₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - E. Charlton₉ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - J Devan₉ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - M. Kordosky₉ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - J.K. Nelson₉ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - B. Pollock₉ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - J. Walding₉ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₉ Department of Physics, College of Wlliam & Mary, Williamsburg. VA 23187 - D. Zhang₉ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₀ Hampton University, Dept. of Physics, Hampton, VA 23668 - M.E. Christy₁₀ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₀ Hampton University, Dept. of Physics, Hampton, VA 23668 - T. Walton₁₀ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₀ Hampton University, Dept. of Physics, Hampton, VA 23668 - L.Y. Zhu₁₀ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₁ Department of Physics and Astronomy, University of Pittsburgh, Pittsburgh PA 15260 - J.Danko₁₁ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₁ Department of Physics and Astronomy, University of Pittsburgh, Pittsburgh PA 15260 - S.A. Dytman₁₁ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₁ Department of Physics and Astronomy, University of Pittsburgh, Pittsburgh PA 15260 - B. Eberly₁₁ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₁ Department of Physics and Astronomy, University of Pittsburgh, Pittsburgh PA 15260 - J.R. Fein₁₁ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₁ Department of Physics and Astronomy, University of Pittsburgh, Pittsburgh PA 15260 - V. Paolone₁₁ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₂ NASA Glenn Research Center, Clevcland OH 44135 - J.M. Downey₁₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₂ NASA Glenn Research Center, Clevcland OH 44135 - O.S. Sands₁₂ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₃ Departamento de Fisica, Universidad de Guanajuato, Campus León, Lomas del Bosque 103 - J. Felix₁₃ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₃ Departamento de Fisica, Universidad de Guanajuato, Campus León, Lomas del Bosque 103 - A. Higuera₁₃ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₃ Departamento de Fisica, Universidad de Guanajuato, Campus León, Lomas del Bosque 103 - G. Zavala₁₃ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - L. Fields₁₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - J.A. Hobbs₁₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - V.A. Kuznetsov₁₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - A.M. Peterman₁₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - H. Schellman₁₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - R.N TIlden₁₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - B.J. Walker₁₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₄ fracc. Lomas del Campestre León GTO. 37150, México - T.P. Wytock₁₄ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₅ Northwestern University, Evanston, IL 60208 - H. Gallagher₁₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₅ Northwestern University, Evanston, IL 60208 - T. Kafka₁₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₅ Northwestern University, Evanston, IL 60208 - W.A. Mann₁₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₅ Northwestern University, Evanston, IL 60208 - W.A. Mann₁₅ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₆ Physics Department, Tutfs Univervily, Medford, MA 02155 - R. Gran₁₆ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₆ Physics Department, Tutfs Univervily, Medford, MA 02155 - M. Lanari₁₆ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₇ Department of Physics, University of Minnesota - Duluth, Duluth, MN 55812 - J. Grange₁₇ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₇ Department of Physics, University of Minnesota - Duluth, Duluth, MN 55812 - J. Mousseau₁₇ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₇ Department of Physics, University of Minnesota - Duluth, Duluth, MN 55812 - B. Osmanov₁₇ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₇ Department of Physics, University of Minnesota - Duluth, Duluth, MN 55812 - H. Ray₁₇ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₇ Department of Physics, University of Minnesota - Duluth, Duluth, MN 55812 - H. Ray₁₇ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - T. Le₁₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - R.D. Ransome₁₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - M. Reyhan₁₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - E.C. Schulte₁₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - V.Takhistov₁₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - B.G. Tice₁₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₈ Rutgers, The State University of New Jersey, Piscataway, NJ 08854 - I. Vergalosova₁₈ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₉ Department of Physics, University of Texas, 1 University Station, Austin, TX 78712 - L. Loiacono₅'₁₉ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₁₉ Department of Physics, University of Texas, 1 University Station, Austin, TX 78712 - R.G. Stevens₁₉ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂₀ Massachusetts College of Liberal Arts, 375 Church St., North Adams, MA 01247 - E. Maher₂₀ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂₁ Department of Physics and Astronomy, Universily of California, Irvine, Irvine, CA 92697-4575 - C. Simon₂₁ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 ₂₁ Department of Physics and Astronomy, Universily of California, Irvine, Irvine, CA 92697-4575 - B.P. Ziemer₂₁ ‏‏‎ ‎ neutrino communication. Is possible, 𝐃𝐄𝐌𝐎𝐍𝐒𝐓𝐑𝐀𝐓𝐈𝐎𝐍 𝐎𝐅 𝐂𝐎𝐌𝐌𝐔𝐍𝐈𝐂𝐀𝐓𝐈𝐎𝐍 𝐔𝐒𝐈𝐍𝐆 𝐍𝐄𝐔𝐓𝐑𝐈𝐍𝐎𝐒 and ₂₂ Otterbein College, One Otterbein College, Westerville, OH, 43081 - and N. Tagg₂₂ ‏‏‎ ‎ neutrino communication. Is possible, neutrino communication. Is possible, by sending

10:37

sending a simple message through through 2 through 240 through 240 meters of rock. -‏‏‎‏‏‎ ( T ) ‏‏‎ ‎ -.‏‏‎‏‏‎ ( N ) ‏‏‎ ‎ -.‏‏‎ ‎ . ( NE ) ‏‏‎ ‎

10:42

-.‏‏‎ ‎ .‏‏‎ ‎ . ( NEE ) ‏‏‎ ‎ -.‏‏‎ ‎ .‏‏‎ ‎ .. ( NEI ) ‏‏‎ ‎ -.‏‏‎ ‎ .‏‏‎ ‎ ..- ( NEU ) ‏‏‎ ‎ -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ - ( NEUT ) ‏‏‎ ‎ -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ . ( NEUTE ) ‏‏‎ ‎ -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .- ( NEUTA ) ‏‏‎ ‎ -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-. ( NEUTR ) ‏‏‎ ‎ -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ . ( NEUTRE ) If advanced life.. -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ .. ( NEUTRI ) If advanced life.. -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ - ( NEUTRIT ) If advanced life.. -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -. ( NEUTRIN ) If advanced life.. -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ - ( NEUTRINT ) If advanced life.. -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ -- ( NEUTRINM ) If advanced life.. -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRINO ) If advanced life.. -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRINO ) ‏‏‎ ‎ -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRINO ) is using them -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRINo ) is using them -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRIno ) is using them -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTRino ) is using them -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUTrino ) is using them -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEUtrino ) is using them -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( NEutrino ) is using them -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( Neutrino ) is using them -.‏‏‎ ‎ .‏‏‎ ‎ ..-‏‏‎ ‎ -‏‏‎ ‎ .-.‏‏‎ ‎ ..‏‏‎ ‎ -.‏‏‎ ‎ --- ( Neutrino ) is using them to communicate, their signals

10:48

signals could travel travel anywhere, through through any obstacle at the at the speed at the speed of light.

10:59

Their messages could be could be streaming through us- ..streaming through us right now, and we.. would have no would have no idea

11:15

; or maybe ; or maybe intelligent life is taking.. an entirely different approach different approach to communication -

11:22

Using space-time itself as a medium.

11:29

By manipulating high high-gravity objects, they could they could in theory create pattern distortions-

11:34

of space-time, which could ripple ripple through ripple through the universe, in all directions.

11:49

But making making gravity waves, strong enough enough to be detectable would be would be extremely would be extremely energy intensive.

11:58

Maybe Maybe they're up to something far simpler -

12:05

Placing giant sunshades sunshades into orbit around a star could block out starlight

12:11

in distinct patterns, like a kind kind of cosmic Morse code.

12:20

And And even though it might take might take years to blink out to blink out a basic message. A system like this,

12:25

would require require little effort require little effort to sustain.

12:33

But the most- ..the most sci-fi possibility of all, is that is that they have left messages messages in our DNA.

12:41

Some have proposed.. that certain certain sequences of our genes AGCTCTCGCAGCTAGCTGACTGACGC GGCTGACGCGTACGCGCTAGCACGAT TGCTCGACGTGACTTTGAACGTCTCGC GCAGGACGCTGACGCTAGCGTCCTAGC AGTCGACGCAGCGCTAGCGACGACTGG TGCTGACTACTTTCCGACTGACGCAGCG GACTGCATGACTGCTAGGTCAGCTGCAC GTGTCAGTCCCTCGGTGATGGATATGGC could contain.. contain hidden messages. GCCCATCGATGCTGATTAATGCGACTAC CCCCGATCCCCATCGCGGAATTATATTA GCACTGACGATGTACGTCAGTGCATGT GCCCTTCCGACTCCTCGACCTATATTTT GCAGTCCTCCCCCTGCGACTCCGCGCG AGCTGACTCCCATCTCTATACGCTAGCG CGACGCCTCCTCTAGAGCGACACTATCT CAGCTGACTCCCTCCTAATATTAATTGCA contain hidden messages.

12:47

Easter eggs Easter eggs in our genetic code, placed by placed by a life-designing life-designing higher intelligence.

12:57

But But far-flung scenarios- ..scenarios like this, are overshadowed by a more sobering possibility...

13:06

maybe maybe we're maybe we're just in the maybe we're just in the wrong place, at the at the wrong time...

13:14

Using a detailed computer model of our galaxy, researchers researchers have estimated that intelligent life

13:21

was possibly was possibly most concentrated.. 4 4,000,000,000 years ago and closer

13:26

to the center to the center of the galaxy.

13:31

If true, then we would exist would exist on the outskirts, light-years away

13:37

and and billions of years too late too late to a galactic too late to a galactic Golden Age.

13:48

Maybe they were here millions of years ago

13:54

witness witness to a whole witness to a whole different planet.

14:10

By now, they might might all be all be long gone, and we could be living in a Galactic

14:15

in a Galactic Graveyard.

14:23

It may It may not be their- ..their signals that we find that we find one day, but their relics.

14:42

As it turns out, our chances of finding an Alien civilization, depend heavily

14:47

on their average their average survival time. If the average lifetime is something

14:52

is something like like 100 years, then they they will will blip in and out of existence, rarely overlapping

14:58

and our chances chances of finding one alive finding one alive are slim.

15:04

But if they they survive for thousands of years or more, then our chances chances will Skyrocket,

15:09

as the potential for overlap expands.

15:17

But what if they're not communicating at all?

15:22

...there's still still a way- we could find them... ‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‏‏‎ ‎

15:31

𝗜𝗜. ‏‏‎ ‎ ‏‏‎ ‎ 𝗜𝗜. 𝗘𝗡𝗚𝗜𝗡𝗘𝗘𝗥𝗦 ‏‏‎ ‎ 𝗜𝗜. 𝗘𝗡𝗚𝗜𝗡𝗘𝗘𝗥𝗦 ᶦⁿ ˢᵉᵃʳᶜʰ ᵒᶠ ᵍᶦᵃⁿᵗˢ

15:41

We tend to assume.. that Alien intelligence would share our motivation our motivation to communicate.

15:50

But they But they may find But they may find the prospect of making of making contact making contact too dangerous or or too futile.

15:58

If If this If this is the case, then we have we have to get to get more creative in our search.

16:04

In In 20 In 2015, astronomers astronomers watched watched as this normal-seeming star began to began to dim

16:10

and erratic waves, unlike anything they'd they'd seen before. they'd seen before. they'd seen before. they'd seen before. they'd seen before.

16:15

The cause cause is probably a giant dust cloud, or or a shattered moon blocking the light,

16:21

but it has all the all the hallmarks of something else of something else - of something else - ‏‏‎ ‎ of something else - An Alien

16:26

of something else - An Alien mega-structure. And even though

16:32

this explanation explanation looks unlikely, it hints it hints at a new way finding intelligent life.

16:39

Not listening Not listening for signals, but looking but looking for their looking for their technology directly

16:47

; not ; not searching for ; not searching for messengers, but searching but searching for engineers.

17:05

And to do that, we have to wonder - what mind-boggling Alien technology,

17:11

should we should we be looking for? Each

17:17

Each Alien civilization would be would be wildly different, but but classifying them by their

17:22

by their energy usage, will give us give us insights into what technology.. they might be using

17:29

- the - the Kardashev Scale - the Kardashev Scale ‏‏‎ ‎ - the Kardashev Scale divides them.. - the Kardashev Scale divides them into 3 levels...

17:35

Type Type One: Type One: ‏‏‎ ‎ Type One: would have Type One: would have a mastery Type One: of their home planet, Type One: ‏‏‎ ‎ ‎Type One: using all the energy.. ‎Type One: using all the energy available on it.

17:40

‎Type One: using all the energy available on it. ‏‏‎ ‎ ‎Type One: using all the energy available on it. ‎Type Two: ‎Type One: using all the energy available on it. ‎Type Two: ‎Type One: using all the energy available on it. ‎Type Two: ‎Type One: using all the energy available on it. ‎Type Two: ‎Type One: using all the energy available on it. ‎Type Two: ‎Type One: using all the energy available on it. ‎Type Two: ‎Type One: using all the energy available on it. ‎Type Two: ‎Type One: using all the energy available on it. ‎Type Two: ‏‏‎ ‎ ‎Type One: using all the energy available on it. ‎Type Two: Type Two, ‎Type One: using all the energy available on it. ‎Type Two: ‏‏‎ ‎ ‎Type One: using all the energy available on it. ‎Type Two: would have mastery ‎Type One: using all the energy available on it. ‎Type Two: over their star,

17:46

‎Type One: using all the energy available on it. ‎Type Two: ‏‏‎ ‎ ‎Type One: using all the energy available on it. ‎Type Two: harnessing all- ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‏‏‎ ‎ ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three,

17:52

‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‏‏‎ ‎ ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‏‏‎ ‎ ‏‏‎ ‎ ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. ‏‏‎ ‎ would have mastery ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: would have mastery ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: over their entire galaxy, ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: ‏‏‎ ‎ ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: and would be more- ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: ..more foreign to us,

17:58

‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: ‏‏‎ ‎ ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: than we are ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: than we are to amoeba. ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: ‏‏‎ ‎ ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: ‎Type One: using all the energy available on it. ‎Type Two: harnessing all its solar energy. Type Three: exotic civilization.

18:05

But before.. we go we go searching for- ..Alien super ..Alien super technology, how do we find find civilizations

18:11

find civilizations like our own, that have yet ..to reach ..to reach Type One? [using all the energy available on it] ..to reach Type One?

18:17

‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‏‏‎ ‎ When a typical planet.. passes in front front of its star,

18:22

we see we see the starlight dim sharply- But observing a more gradual fall off

18:28

fall off of starlight, could be evidence of a dense dense ring of satellites dense ring of satellites - dense ring of satellites - ‏‏‎ ‎ dense ring of satellites - A Clarke Belt,

18:39

spotting spotting this type this type of light curve, wouldn't be a Smoking-gun, but but rings around-

18:44

around rocky planets.. are unusual, and it could point us in the right direction.

18:56

Just as Alien vegetation, would leave a.. a Biosignature in its atmosphere ; Alien technology,

19:02

would leave would leave a would leave a Technosignature. Silicon Silicon produces..

19:08

a recognizable light curve- similar to Chlorophyll. Spotting Spotting this signal,

19:14

could point us ..point us to the presence of Alien Solar-cells.

19:29

And something- ..something more nefarious, might also leave its mark on a on a foreign atmosphere..

19:37

- Alien pollution,

19:49

certain pollutants - like Chlorofluorocarbons, aren't aren't produced by nature,

19:54

and could be detectable.. even even in small amounts.

20:01

These chemicals could even could even linger long-after a civilization dies,

20:07

pointing us pointing us to the remains of an extinct of an extinct Alien race.

20:24

Such a discovery could give us give us crucial guidance, on how to- to avoid avoid our own avoid our own extinction.

20:35

And there's And there's another another universal hazard we would be we would be familiar with.

20:44

Any civilization that uses huge amounts of energy, will produce huge amounts huge amounts of waste heat.

20:52

This excess heat could prove a serious threat - Just - Just as Climate Change ..does to us.

21:00

But But it could also also leave leave a Tell-tale Signal.

21:06

Finding waste heat radiating.. radiating from Alien planets, or other regions of space,

21:11

could point the way to intelligent activity.

21:28

If not If not exterminated by their their own technology, some life-forms may achieve total control

21:34

over their planet, and. and become a a Type One

21:40

a Type One civilization

21:53

With this mastery would come incredible powers; control

21:59

control over all all their world's their world's ecosystems, its resources, and even and even its weather.

22:08

But no no matter no matter how advanced, every every planetary civilization will face will face the same- ..the same cosmic threats

22:14

..same cosmic threats we do ..same cosmic threats we do - ..same cosmic threats we do - ‏‏‎ ‎ ..same cosmic threats we do - GRBs,

22:19

..same cosmic threats we do - GRBs, supernovas ..same cosmic threats we do - supernovas and ..same cosmic threats we do - ..supernovas and asteroid impacts, ..supernovas and asteroid impacts, will be ..be a risk factor for for any terrestrial race.

22:29

Some might decide to flee to Intergalactic space. Reducing Reducing their exposure

22:34

to existential risks, making making their home in the voids between the stars.

22:44

If so, then our search will have to encompass- ..encompass the entire ..encompass the entire swath of the universe.

22:54

But But Alien life Alien life that decides.. to stay stay planted bound, will need need long-term need long-term protection

23:00

need long-term protection..

23:29

- the best way to protect to protect your world, would be be the ultimate in-home defense in-home defense..

23:36

[] [ ] [‏‏‎‏‏‎‏‏‎ ‏‏‎ ‎‎‏‏‎ ‎‎‎] [ 3 ] [ 3 ] [ 3 ] ‏‏‎ ‎ [ 3 ] - a [ 3 ] - a Planetary [ 3 ] - a Planetary Shield [ 3 ] - a Planetary Shield

23:41

[‏‏‎‏‏‎‏‏‎ ‏‏‎ ‎‎‏‏‎ ‎‎‎] - a Planetary Shield [ ] - a Planetary Shield [] - a Planetary Shield - a Planetary Shield

23:56

,these shields would cause- ..cause a Tell-tale a Tell-tale Dimming Pattern during transit,

24:01

and and could also emit a a detectable heat signature.

24:10

Large-scale astro-engineering astro-engineering like this, would would require a colossal amount colossal amount of resources.

24:17

And the And the easiest way to get them, may not be.. be from mining planets

24:22

- But from.. from mining asteroids,

24:40

they're resource-rich and easier and easier to manipulate because of because of their lower gravity.

24:49

Searching distant asteroid fields.. asteroid fields for temperature or chemical or chemical anomalies, could indicate

24:54

could indicate Alien mining activity.

25:01

Eventually though, asteroids asteroids might not asteroids might not be enough..

25:28

Since Since our our civilization is.. civilization is so new, any any other- ..other intelligent life is likely is likely to be

25:33

more advanced than us. So we So we should think think twice before revealing revealing our presence.

25:42

‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‏‏‎ ‎ But But Alien Alien super civilizations-

25:47

won't just be be looking for resources. They will will also need

25:53

staggering amounts staggering amounts of energy staggering amounts of energy. staggering amounts of energy.. - Stars

25:58

..output billions of times more energy more energy than planets more energy than planets receive,

26:04

To harness harness it all, requires requires building something truly something truly mind something truly mind-boggling something truly mind-boggling..

26:12

- Dyson Spheres are enormous enormous mega-structures that that encircle encircle a star,

26:18

designed to designed to capture.. its entire its entire energy output.

26:30

They could also also double as vast habitats.. habitats for life.

26:36

A solid shell Solid shell would be be physically be physically unstable, so instead so instead of a sphere,

26:41

we might ..find ..find a cloud ..find a cloud object ..find a cloud object - ..find a cloud object - ‏‏‎ ‎ ..find a cloud object - A Dyson ..find a cloud object - A Dyson Swarm

26:47

..find a cloud object - A Dyson Swarm,

27:04

no matter their design, they would would generate an an enormous an enormous amount of infrared infrared waste heat,

27:15

and they could also eclipse- or even block out block out the star's light block out the star's light entirely.

27:25

Dyson Spheres could also be built be built around be built around black holes, which could have have a smaller radius,

27:31

and collect thousands thousands of times more energy.

27:42

Any beings.. that come that come to harness to harness their stars entire energy output,

27:47

will reach will reach the next level on the Kardashev Scale

27:54

- A Type - A Type Two civilization, [harnessing all its solar energy] - A Type Two civilization,

28:04

this level this level of mastery.. would imply imply an astounding capability.

28:13

Star-lifting, is the is the practice practice of harvesting harvesting stellar material, and could provide thousands

28:18

thousands of planets planets worth of resources.

28:24

This process.. would also would also allow you to lower the temperature lower the temperature of the star,

28:29

postponing postponing its death by by billions by billions of years.

28:37

In In about In about 1 about 1 about 1,000,000,000 about 1,000,000,000 years time. Our own Our own sun will grow will grow too hot for life on Earth.

28:45

If we If we ever find evidence of star-lifting, it could it could Inspire.. it could Inspire us to one day do the same,

28:52

and prolong- and prolong the game and prolong the game of life.

29:11

Eventually, there may there may be life that outgrows that outgrows its that outgrows its star.. - And needs

29:17

even even more even more energy.

29:30

To branch out across the galaxy, life-forms this advance this advance will probably need

29:36

near light-speed travel.

29:41

And if And if they do- ..do have this capability, there's a chance we could catch them we could catch them in the act...

29:54

Alien Alien starships that hit the brakes at lightspeed, at lightspeed, could leave behind a long trail

29:59

a long trail of ionized gas

30:04

a long trail of ionized gas. a long trail of ionized gas.. a long trail of ionized gas...

30:11

These trails These trails might emit detectable detectable infrared radiation.

30:20

Strokes of light, ..painted ..painted by masters ..painted by masters of the universe.

30:32

‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‏‏‎ ‎ Once life-forms have harnessed have harnessed all the energy

30:38

their galaxy their galaxy can provide, they will achieve unimaginable power..

30:46

- A - A Type - A Type Three civilization, [exotic civilization] - A Type Three civilization,

31:02

this cosmic this cosmic virtuosity would be would be totally unfathomable.. unfathomable to us.

31:09

Life Life that is built billions of billions of Dyson Spheres, and and can create and can create stars and can create stars at will.

31:18

In theory, their thirst their thirst for energy could make a whole a whole galaxy.. a whole galaxy go dark.

31:29

So one way to search to search for Type Three life-forms.. is to to look for- look for what's not there

31:37

- In distant space, there are there are huge voids between clusters of galaxies,

31:42

..were no light eminence. These voids

31:47

were were once thought to be to be evidence of advanced life, having having harnessed having harnessed the energy from every star

31:53

in the region. But But it But it turns out,

31:59

they are they are naturally they are naturally occurring- .."features" of the ..of the universe, and the- the recent analysis

32:04

of of nearby of nearby galaxies, revealed no evidence of any any galactic-scale galactic-scale civilizations...

32:16

𝗜𝗳 𝗰𝗶𝘃𝗶𝗹𝗶𝘇𝗮𝘁𝗶𝗼𝗻𝘀 𝘁𝗵𝗶𝘀 𝗮𝗱𝘃𝗮𝗻𝗰𝗲𝗱 𝗮𝗿𝗲 𝗼𝘂𝘁 𝘁𝗵𝗲𝗿𝗲, 𝗺𝗮𝘆𝗯𝗲 𝘁𝗵𝗲𝘆 𝗵𝗮𝘃𝗲 𝗰𝗵𝗼𝘀𝗲𝗻 𝘁𝗼 𝗿𝗲𝗺𝗮𝗶𝗻 𝗶𝗻𝘃𝗶𝘀𝗶𝗯𝗹𝗲. 𝗜𝗳 𝗰𝗶𝘃𝗶𝗹𝗶𝘇𝗮𝘁𝗶𝗼𝗻𝘀 𝘁𝗵𝗶𝘀 𝗮𝗱𝘃𝗮𝗻𝗰𝗲𝗱 𝗮𝗿𝗲 𝗼𝘂𝘁 𝘁𝗵𝗲𝗿𝗲, 𝗺𝗮𝘆𝗯𝗲 𝘁𝗵𝗲𝘆 𝗵𝗮𝘃𝗲 𝗰𝗵𝗼𝘀𝗲𝗻 𝘁𝗼 𝗿𝗲𝗺𝗮𝗶𝗻 𝗶𝗻𝘃𝗶𝘀𝗶𝗯𝗹𝗲. 𝗜𝗳 𝗰𝗶𝘃𝗶𝗹𝗶𝘇𝗮𝘁𝗶𝗼𝗻𝘀 𝘁𝗵𝗶𝘀 𝗮𝗱𝘃𝗮𝗻𝗰𝗲𝗱 𝗮𝗿𝗲 𝗼𝘂𝘁 𝘁𝗵𝗲𝗿𝗲, 𝗺𝗮𝘆𝗯𝗲 𝘁𝗵𝗲𝘆 𝗵𝗮𝘃𝗲 𝗰𝗵𝗼𝘀𝗲𝗻 𝘁𝗼 𝗿𝗲𝗺𝗮𝗶𝗻 𝗶𝗻𝘃𝗶𝘀𝗶𝗯𝗹𝗲.

32:27

𝗜𝗳 𝗰𝗶𝘃𝗶𝗹𝗶𝘇𝗮𝘁𝗶𝗼𝗻𝘀 𝘁𝗵𝗶𝘀 𝗮𝗱𝘃𝗮𝗻𝗰𝗲𝗱 𝗮𝗿𝗲 𝗼𝘂𝘁 𝘁𝗵𝗲𝗿𝗲, 𝗺𝗮𝘆𝗯𝗲 𝘁𝗵𝗲𝘆 𝗵𝗮𝘃𝗲 𝗰𝗵𝗼𝘀𝗲𝗻 𝘁𝗼 𝗿𝗲𝗺𝗮𝗶𝗻 𝗶𝗻𝘃𝗶𝘀𝗶𝗯𝗹𝗲. 𝗜𝗳 𝗰𝗶𝘃𝗶𝗹𝗶𝘇𝗮𝘁𝗶𝗼𝗻𝘀 𝘁𝗵𝗶𝘀 𝗮𝗱𝘃𝗮𝗻𝗰𝗲𝗱 𝗮𝗿𝗲 𝗼𝘂𝘁 𝘁𝗵𝗲𝗿𝗲, 𝗺𝗮𝘆𝗯𝗲 𝘁𝗵𝗲𝘆 𝗵𝗮𝘃𝗲 𝗰𝗵𝗼𝘀𝗲𝗻 𝘁𝗼 𝗿𝗲𝗺𝗮𝗶𝗻 𝗶𝗻𝘃𝗶𝘀𝗶𝗯𝗹𝗲. 𝗜𝗳 𝗰𝗶𝘃𝗶𝗹𝗶𝘇𝗮𝘁𝗶𝗼𝗻𝘀 𝘁𝗵𝗶𝘀 𝗮𝗱𝘃𝗮𝗻𝗰𝗲𝗱 𝗮𝗿𝗲 𝗼𝘂𝘁 𝘁𝗵𝗲𝗿𝗲, 𝗺𝗮𝘆𝗯𝗲 𝘁𝗵𝗲𝘆 𝗵𝗮𝘃𝗲 𝗰𝗵𝗼𝘀𝗲𝗻 𝘁𝗼 𝗿𝗲𝗺𝗮𝗶𝗻 𝗶𝗻𝘃𝗶𝘀𝗶𝗯𝗹𝗲. 𝗜𝗳 𝗰𝗶𝘃𝗶𝗹𝗶𝘇𝗮𝘁𝗶𝗼𝗻𝘀 𝘁𝗵𝗶𝘀 𝗮𝗱𝘃𝗮𝗻𝗰𝗲𝗱 𝗮𝗿𝗲 𝗼𝘂𝘁 𝘁𝗵𝗲𝗿𝗲, 𝗺𝗮𝘆𝗯𝗲 𝘁𝗵𝗲𝘆 𝗵𝗮𝘃𝗲 𝗰𝗵𝗼𝘀𝗲𝗻 𝘁𝗼 𝗿𝗲𝗺𝗮𝗶𝗻 𝗶𝗻𝘃𝗶𝘀𝗶𝗯𝗹𝗲.

32:32

𝗕𝘂𝘁 𝗶𝗳 𝘄𝗲'𝗿𝗲 𝗹𝘂𝗰𝗸𝘆, 𝗶𝗻𝘀𝘁𝗲𝗮𝗱 𝗼𝗳 𝗵𝗶𝗱𝗶𝗻𝗴, 𝘁𝗵𝗲𝘆'𝗹𝗹 𝗰𝗿𝗲𝗮𝘁𝗲 𝘀𝗼𝗺𝗲𝘁𝗵𝗶𝗻𝗴 𝘂𝗻𝗺𝗶𝘀𝘁𝗮𝗸𝗮𝗯𝗹𝘆 𝗮𝗹𝗶𝗲𝗻. 𝗕𝘂𝘁 𝗶𝗳 𝘄𝗲'𝗿𝗲 𝗹𝘂𝗰𝗸𝘆, 𝗶𝗻𝘀𝘁𝗲𝗮𝗱 𝗼𝗳 𝗵𝗶𝗱𝗶𝗻𝗴, 𝘁𝗵𝗲𝘆'𝗹𝗹 𝗰𝗿𝗲𝗮𝘁𝗲 𝘀𝗼𝗺𝗲𝘁𝗵𝗶𝗻𝗴 𝘂𝗻𝗺𝗶𝘀𝘁𝗮𝗸𝗮𝗯𝗹𝘆 𝗮𝗹𝗶𝗲𝗻.

32:55

In theory, ..cosmic architects could assemble could assemble an enormous an enormous planetary systems,

33:00

far more far more intricate than anything- ..anything nature nature could produce

33:05

nature could produce ‏‏‎ ‎ nature could produce - One possible nature could produce - One possible system.. that would be gravitationally stable- involves involves 9 involves 9 Sun-like

33:11

involves 9 Sun-like stars orbiting a supermassive orbiting a supermassive black hole, which could support.. could support.. could support 5

33:16

could support 550 could support 550 Earth-like could support 550 Earth-like planets in habitable zones.

33:23

[] [ ] [‏‏‎‏‏‎‏‏‎ ‏‏‎ ‎‎‏‏‎ ‎‎‎] [ 4 ] [ 4 ] [ 4 ] ‏‏‎ ‎ [ 4 ] These artisanal solar systems [ 4 ] ‏‏‎ ‎ [ 4 ] could make [ 4 ] could make ideal- [ 4 ] ..ideal long-term [ 4 ] ..long-term habitats.

33:28

[ 4 ] ..long-term habitats. [‏‏‎‏‏‎‏‏‎ ‏‏‎ ‎‎‏‏‎ ‎‎‎] ..long-term habitats. [ ] ..long-term habitats. [] ..long-term habitats. ..long-term habitats. Or Or could even.. function as function as an Alien an Alien nature reserve,

33:35

with each planet hosting hosting a different a different strain- a different strain of a different strain of life...

33:53

It's hard to- hard to imagine imagine any life-forms more advanced more advanced than this.

34:05

But in But in theory, there could there could be beings that that control or created our universe itself.

34:15

Researchers are beginning are beginning are beginning are beginning are beginning are beginning are beginning are beginning are beginning are beginning to test to test the idea, that reality that reality itself.. is just is just a simulation

34:21

is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation is just a simulation ; or an ; or an experiment run by run by some.. by some higher by some higher order by some higher order bead.

34:29

by some higher order bead. by some higher order bead. by some higher order bead. by some higher order bead. by some higher order bead. by some higher order bead. by some higher order bead. by some higher order bead. by some higher order bead. b̷̹̪̣͔̏̈̾̀̾͠ý̷̠̞̝͔̬̗͋̔̈́͒̆͂̚ ̷̖̪́̍͘͝s̸̤͔͋͛͛̓̄o̸̟͎̘̝͖̳̺̖̮͒m̸̫̥̗̲̱̈́̐͂͜e̸̮͍͝ ̶̢̡̫͉̯́́̇͂̌̾͐͘͝͝ḥ̴̨͙̹͙̩͍̗̆͜ḯ̷̧̧͔͓͚͋̃̈̔̕͠g̸̢̨̮̱̹̋͛͆̋̀̕̚͠͠h̶͕͇͈̪͙̿e̶̮͙͋́̔̕͝r̷̻͉̞̤͒̒̓̎͑̃͐̑͠ ̶̧̧̫̰̯̞̮͖̠̽̏̑͗̇̿̋͜͝ǫ̴͎̼̆̇̔̈́̔̐͑̔̕r̸͙̈̚͠d̸͖̯͍́̏̽͜e̷̛̟̗͇̋̍̎͌͂͒͋̚̚ṙ̴̡̠̥̖͇̯͑̀͊͊̈́̎̏̑͜ ̸̺͇̫͉̜̄̾͐ḃ̷̛̻̜̪̆̈́̈́̆̏e̷͙̠͌͝a̸̡͚͍͕̗̟͓̾ͅḋ̴͇̹̗̭͆̾͐̔̎̿̕͘ͅ.̶͔͚̤̺̮̱̬̍̈́̀̆̏ ๒ץ ร๏๓є ђเﻮђєг ๏г๔єг ๒єค๔. Ⴆყ ʂσɱҽ ԋιɠԋҽɾ σɾԃҽɾ Ⴆҽαԃ. ɮʏ ֆօʍɛ ɦɨɢɦɛʀ օʀɖɛʀ ɮɛǟɖ. ᏰᎩ ᏕᎧᎷᏋ ᏂᎥᎶᏂᏋᏒ ᎧᏒᎴᏋᏒ ᏰᏋᏗᎴ. ცყ ʂơɱɛ ɧıɠɧɛཞ ơཞɖɛཞ ცɛąɖ. ๖ฯ Ş໐๓ē hiງhēr ໐r໓ēr ๖ēค໓. 𝚋𝚢 𝚜𝚘𝚖𝚎 𝚑𝚒𝚐𝚑𝚎𝚛 𝚘𝚛𝚍𝚎𝚛 𝚋𝚎𝚊𝚍. BY ƧӨMΣ ΉIGΉΣЯ ӨЯDΣЯ BΣΛD. ߥ §ðmê hïghêr ðrÐêr ßêåÐ. ฿Ɏ ₴Ø₥Ɇ Ⱨł₲ⱧɆⱤ ØⱤĐɆⱤ ฿Ɇ₳Đ. #^ So3@ EOndcr PfD#d OEIU. @3 SoW() E0ndcr PfD#d OEIU. -. ---- E0ndcr PfD#d OEIU. -. ---- --.--. PfD#d OEIU. PfD#d OEIU -. ---- --.--.

34:35

Anything this this advanced would would transcend our ideas.. our ideas of life itself,

34:41

as they as they would exist outside outside of time- outside of time and space.

34:48

‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ In a way, the search the search for intelligent life is an

34:54

is an evolution of the of the age-old of the age-old search ..age-old search for god.

35:01

Both Both are driven by a longing for truth, and connection with with something bigger

35:06

than ourselves...

35:21

And And what if what if we do.. find a signal find a signal one day. What happens

35:27

when the ancient dream ancient dream becomes reality? ‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‏‏‎ ‎ 𝗜𝗜𝗜. ‏‏‎ ‎ ‏‏‎ ‎

35:33

𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ‏‏‎ ‎ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ

35:38

𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ 𝗜𝗜𝗜. 𝗖𝗢𝗡𝗧𝗔𝗖𝗧 ᶜᶦᵛᶦˡᶦᶻᵉ ᶜᵒᵐᵐᵘⁿᶦᶜᵃᵗᶦᵒⁿ

35:45

Just knowing.. they're out there, would profoundly- ..profoundly change how we see how we see ourselves.

36:04

For the first time, we would would fuel would fuel the true sense of cosmic brotherhood.

36:25

And studying their studying their messages or technology, could lead us to huge to huge advancements

36:30

and help secure- our own.. our own long-term our own long-term survival.

36:52

But But the possibility of meaningful- ..Two-way ..Two-way communication would be would be bleak

36:57

would be bleak ‏‏‎ ‎ would be bleak - Separated would be bleak - Separated by hundreds.. hundreds or hundreds or thousands of light-years, we would be

37:02

be studying these studying these civilizations.. as they as they were in the- ..were in the deep past.

37:11

And our experience of language, could be.. be entirely entirely foreign entirely foreign to them.

37:33

𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳,‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ 𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳, 𝗮𝗳𝘁𝗲𝗿 𝗮𝗹𝗹 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴 ‏‏‎ ‎ 𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳,‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ 𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳, 𝗮𝗳𝘁𝗲𝗿 𝗮𝗹𝗹 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴 ‏‏‎ ‎ 𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳, 𝗮𝗳𝘁𝗲𝗿 𝗮𝗹𝗹 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴 𝘄𝗲 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱 𝗮𝗻𝗼𝘁𝗵𝗲𝗿 𝘀𝗶𝗴𝗻 𝗼𝗳 𝗜𝗻𝘁𝗲𝗹𝗹𝗶𝗴𝗲𝗻𝗰𝗲. 𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳, 𝗮𝗳𝘁𝗲𝗿 𝗮𝗹𝗹 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴 ‏‏‎ ‎ 𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳, 𝗮𝗳𝘁𝗲𝗿 𝗮𝗹𝗹 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴 𝘄𝗲 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱 𝗮𝗻𝗼𝘁𝗵𝗲𝗿 𝘀𝗶𝗴𝗻 𝗼𝗳 𝗜𝗻𝘁𝗲𝗹𝗹𝗶𝗴𝗲𝗻𝗰𝗲. 𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳, 𝗮𝗳𝘁𝗲𝗿 𝗮𝗹𝗹 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴 ‏‏‎ ‎ 𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳, 𝗮𝗳𝘁𝗲𝗿 𝗮𝗹𝗹 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴 𝘄𝗲 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱 𝗮𝗻𝗼𝘁𝗵𝗲𝗿 𝘀𝗶𝗴𝗻 𝗼𝗳 𝗜𝗻𝘁𝗲𝗹𝗹𝗶𝗴𝗲𝗻𝗰𝗲.

37:39

𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳, 𝗮𝗳𝘁𝗲𝗿 𝗮𝗹𝗹 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴 𝘄𝗲 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱 𝗮𝗻𝗼𝘁𝗵𝗲𝗿 𝘀𝗶𝗴𝗻 𝗼𝗳 𝗜𝗻𝘁𝗲𝗹𝗹𝗶𝗴𝗲𝗻𝗰𝗲. 𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳, 𝗮𝗳𝘁𝗲𝗿 𝗮𝗹𝗹 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴 𝘄𝗲 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱 𝗮𝗻𝗼𝘁𝗵𝗲𝗿 𝘀𝗶𝗴𝗻 𝗼𝗳 𝗜𝗻𝘁𝗲𝗹𝗹𝗶𝗴𝗲𝗻𝗰𝗲. 𝗕𝘂𝘁 𝘄𝗵𝗮𝘁 𝗶𝗳, 𝗮𝗳𝘁𝗲𝗿 𝗮𝗹𝗹 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵𝗶𝗻𝗴 𝘄𝗲 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱 𝗮𝗻𝗼𝘁𝗵𝗲𝗿 𝘀𝗶𝗴𝗻 𝗼𝗳 𝗜𝗻𝘁𝗲𝗹𝗹𝗶𝗴𝗲𝗻𝗰𝗲. 𝗪𝗵𝗮𝘁 𝗶𝗳 𝘄𝗲 𝗿𝗲𝗮𝗹𝗹𝘆 𝗮𝗿𝗲 𝗮𝗹𝗼𝗻𝗲?

37:52

𝗪𝗲 𝗰𝗮𝗻 𝗻𝗲𝘃𝗲𝗿 𝗯𝗲 𝘁𝗿𝘂𝗹𝘆 𝘀𝘂𝗿𝗲 𝗮𝘀 𝘁𝗵𝗲𝗿𝗲 𝘄𝗶𝗹𝗹 𝗮𝗹𝘄𝗮𝘆𝘀 ‏‏‎ ‎ 𝗪𝗲 𝗰𝗮𝗻 𝗻𝗲𝘃𝗲𝗿 𝗯𝗲 𝘁𝗿𝘂𝗹𝘆 𝘀𝘂𝗿𝗲 𝗮𝘀 𝘁𝗵𝗲𝗿𝗲 𝘄𝗶𝗹𝗹 𝗮𝗹𝘄𝗮𝘆𝘀 ‏‏‎ ‎ 𝗪𝗲 𝗰𝗮𝗻 𝗻𝗲𝘃𝗲𝗿 𝗯𝗲 𝘁𝗿𝘂𝗹𝘆 𝘀𝘂𝗿𝗲 𝗮𝘀 𝘁𝗵𝗲𝗿𝗲 𝘄𝗶𝗹𝗹 𝗮𝗹𝘄𝗮𝘆𝘀 ‏‏‎ ‎ 𝗪𝗲 𝗰𝗮𝗻 𝗻𝗲𝘃𝗲𝗿 𝗯𝗲 𝘁𝗿𝘂𝗹𝘆 𝘀𝘂𝗿𝗲 𝗮𝘀 𝘁𝗵𝗲𝗿𝗲 𝘄𝗶𝗹𝗹 𝗮𝗹𝘄𝗮𝘆𝘀 𝗯𝗲 𝗱𝗶𝘀𝘁𝗮𝗻𝘁 𝗴𝗮𝗹𝗮𝘅𝗶𝗲𝘀 𝘁𝗼𝗼 𝗳𝗮𝗿 𝘁𝗼 𝗲𝘃𝗲𝗿 𝘀𝘁𝘂𝗱𝘆. 𝗪𝗲 𝗰𝗮𝗻 𝗻𝗲𝘃𝗲𝗿 𝗯𝗲 𝘁𝗿𝘂𝗹𝘆 𝘀𝘂𝗿𝗲 𝗮𝘀 𝘁𝗵𝗲𝗿𝗲 𝘄𝗶𝗹𝗹 𝗮𝗹𝘄𝗮𝘆𝘀 ‏‏‎ ‎ 𝗪𝗲 𝗰𝗮𝗻 𝗻𝗲𝘃𝗲𝗿 𝗯𝗲 𝘁𝗿𝘂𝗹𝘆 𝘀𝘂𝗿𝗲 𝗮𝘀 𝘁𝗵𝗲𝗿𝗲 𝘄𝗶𝗹𝗹 𝗮𝗹𝘄𝗮𝘆𝘀 𝗯𝗲 𝗱𝗶𝘀𝘁𝗮𝗻𝘁 𝗴𝗮𝗹𝗮𝘅𝗶𝗲𝘀 𝘁𝗼𝗼 𝗳𝗮𝗿 𝘁𝗼 𝗲𝘃𝗲𝗿 𝘀𝘁𝘂𝗱𝘆.

37:59

𝗪𝗲 𝗰𝗮𝗻 𝗻𝗲𝘃𝗲𝗿 𝗯𝗲 𝘁𝗿𝘂𝗹𝘆 𝘀𝘂𝗿𝗲 𝗮𝘀 𝘁𝗵𝗲𝗿𝗲 𝘄𝗶𝗹𝗹 𝗮𝗹𝘄𝗮𝘆𝘀 𝗯𝗲 𝗱𝗶𝘀𝘁𝗮𝗻𝘁 𝗴𝗮𝗹𝗮𝘅𝗶𝗲𝘀 𝘁𝗼𝗼 𝗳𝗮𝗿 𝘁𝗼 𝗲𝘃𝗲𝗿 𝘀𝘁𝘂𝗱𝘆. 𝗪𝗲 𝗰𝗮𝗻 𝗻𝗲𝘃𝗲𝗿 𝗯𝗲 𝘁𝗿𝘂𝗹𝘆 𝘀𝘂𝗿𝗲 𝗮𝘀 𝘁𝗵𝗲𝗿𝗲 𝘄𝗶𝗹𝗹 𝗮𝗹𝘄𝗮𝘆𝘀 𝗯𝗲 𝗱𝗶𝘀𝘁𝗮𝗻𝘁 𝗴𝗮𝗹𝗮𝘅𝗶𝗲𝘀 𝘁𝗼𝗼 𝗳𝗮𝗿 𝘁𝗼 𝗲𝘃𝗲𝗿 𝘀𝘁𝘂𝗱𝘆. 𝗪𝗲 𝗰𝗮𝗻 𝗻𝗲𝘃𝗲𝗿 𝗯𝗲 𝘁𝗿𝘂𝗹𝘆 𝘀𝘂𝗿𝗲 𝗮𝘀 𝘁𝗵𝗲𝗿𝗲 𝘄𝗶𝗹𝗹 𝗮𝗹𝘄𝗮𝘆𝘀 𝗯𝗲 𝗱𝗶𝘀𝘁𝗮𝗻𝘁 𝗴𝗮𝗹𝗮𝘅𝗶𝗲𝘀 𝘁𝗼𝗼 𝗳𝗮𝗿 𝘁𝗼 𝗲𝘃𝗲𝗿 𝘀𝘁𝘂𝗱𝘆. 𝗕𝘂𝘁 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗮𝗻𝘆 𝗲𝘃𝗶𝗱𝗲𝗻𝗰𝗲 𝘄𝗼𝘂𝗹𝗱 𝗺𝗲𝗮𝗻 𝘁𝗵𝗮𝘁 𝗼𝘂𝗿 𝗽𝗹𝗮𝗰𝗲 𝗶𝗻 𝘁𝗵𝗲 𝘂𝗻𝗶𝘃𝗲𝗿𝘀𝗲 𝗶𝘀 𝘁𝗿𝘂𝗹𝘆 𝘂𝗻𝗶𝗾𝘂𝗲. 𝗕𝘂𝘁 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗮𝗻𝘆 𝗲𝘃𝗶𝗱𝗲𝗻𝗰𝗲 𝘄𝗼𝘂𝗹𝗱 𝗺𝗲𝗮𝗻 𝘁𝗵𝗮𝘁 𝗼𝘂𝗿 𝗽𝗹𝗮𝗰𝗲 𝗶𝗻 𝘁𝗵𝗲 𝘂𝗻𝗶𝘃𝗲𝗿𝘀𝗲 𝗶𝘀 𝘁𝗿𝘂𝗹𝘆 𝘂𝗻𝗶𝗾𝘂𝗲.

38:08

𝗕𝘂𝘁 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗮𝗻𝘆 𝗲𝘃𝗶𝗱𝗲𝗻𝗰𝗲 𝘄𝗼𝘂𝗹𝗱 𝗺𝗲𝗮𝗻 𝘁𝗵𝗮𝘁 𝗼𝘂𝗿 𝗽𝗹𝗮𝗰𝗲 𝗶𝗻 𝘁𝗵𝗲 𝘂𝗻𝗶𝘃𝗲𝗿𝘀𝗲 𝗶𝘀 𝘁𝗿𝘂𝗹𝘆 𝘂𝗻𝗶𝗾𝘂𝗲. 𝗕𝘂𝘁 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗮𝗻𝘆 𝗲𝘃𝗶𝗱𝗲𝗻𝗰𝗲 𝘄𝗼𝘂𝗹𝗱 𝗺𝗲𝗮𝗻 𝘁𝗵𝗮𝘁 𝗼𝘂𝗿 𝗽𝗹𝗮𝗰𝗲 𝗶𝗻 𝘁𝗵𝗲 𝘂𝗻𝗶𝘃𝗲𝗿𝘀𝗲 𝗶𝘀 𝘁𝗿𝘂𝗹𝘆 𝘂𝗻𝗶𝗾𝘂𝗲. 𝗕𝘂𝘁 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗮𝗻𝘆 𝗲𝘃𝗶𝗱𝗲𝗻𝗰𝗲 𝘄𝗼𝘂𝗹𝗱 𝗺𝗲𝗮𝗻 𝘁𝗵𝗮𝘁 𝗼𝘂𝗿 𝗽𝗹𝗮𝗰𝗲 𝗶𝗻 𝘁𝗵𝗲 𝘂𝗻𝗶𝘃𝗲𝗿𝘀𝗲 𝗶𝘀 𝘁𝗿𝘂𝗹𝘆 𝘂𝗻𝗶𝗾𝘂𝗲. 𝗕𝘂𝘁 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗮𝗻𝘆 𝗲𝘃𝗶𝗱𝗲𝗻𝗰𝗲 𝘄𝗼𝘂𝗹𝗱 𝗺𝗲𝗮𝗻 𝘁𝗵𝗮𝘁 𝗼𝘂𝗿 𝗽𝗹𝗮𝗰𝗲 𝗶𝗻 𝘁𝗵𝗲 𝘂𝗻𝗶𝘃𝗲𝗿𝘀𝗲 𝗶𝘀 𝘁𝗿𝘂𝗹𝘆 𝘂𝗻𝗶𝗾𝘂𝗲. 𝗕𝘂𝘁 𝗻𝗲𝘃𝗲𝗿 𝗳𝗶𝗻𝗱𝗶𝗻𝗴 𝗮𝗻𝘆 𝗲𝘃𝗶𝗱𝗲𝗻𝗰𝗲 𝘄𝗼𝘂𝗹𝗱 𝗺𝗲𝗮𝗻 𝘁𝗵𝗮𝘁 𝗼𝘂𝗿 𝗽𝗹𝗮𝗰𝗲 𝗶𝗻 𝘁𝗵𝗲 𝘂𝗻𝗶𝘃𝗲𝗿𝘀𝗲 𝗶𝘀 𝘁𝗿𝘂𝗹𝘆 𝘂𝗻𝗶𝗾𝘂𝗲. It would It would saddle us

38:14

with an with an immense ..an immense an immense responsibility -to keep -to keep the flame the flame of intelligence the flame of intelligence alive...

38:26

Just Just as Just as ancient Just as ancient civilizations speak to us- through their monuments, we could build build monuments

38:31

of our own for future life to discover

38:37

; Cosmic time capsules preserving preserving a record of our of our achievements, and our knowledge...

38:55

‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‏‏‎ ‎ Perhaps other racers will do will do the same,

39:01

and these and these memory vaults.. could become- ..could become connected become connected become connected over time.. - Each new - Each new civilization..

39:07

- Each new civilization adding a link,

39:14

it could could be could be our could be our destiny.. to be to be the first link in this chain.

39:20

To be ..the founders of a of a Galactic- of a Galactic Encyclopedia, built built upon

39:25

by by future by future life-forms we will we will never meet...

39:50

𝗙𝗼𝗿 𝘀𝗼𝗰𝗶𝗮𝗹 𝗰𝗿𝗲𝗮𝘁𝘂𝗿𝗲𝘀 𝗹𝗶𝗸𝗲 𝘂𝘀, 𝘀𝘁𝗮𝗿𝗶𝗻𝗴 𝘂𝗽 𝗮𝘁 𝗮 𝗹𝗼𝗻𝗲𝗹𝘆 𝗻𝗶𝗴𝗵𝘁 𝘀𝗸𝘆 𝗶𝘀 𝗮 𝗰𝘂𝗿𝘀𝗲. 𝗙𝗼𝗿 𝘀𝗼𝗰𝗶𝗮𝗹 𝗰𝗿𝗲𝗮𝘁𝘂𝗿𝗲𝘀 𝗹𝗶𝗸𝗲 𝘂𝘀, 𝘀𝘁𝗮𝗿𝗶𝗻𝗴 𝘂𝗽 𝗮𝘁 𝗮 𝗹𝗼𝗻𝗲𝗹𝘆 𝗻𝗶𝗴𝗵𝘁 𝘀𝗸𝘆 𝗶𝘀 𝗮 𝗰𝘂𝗿𝘀𝗲. 𝗙𝗼𝗿 𝘀𝗼𝗰𝗶𝗮𝗹 𝗰𝗿𝗲𝗮𝘁𝘂𝗿𝗲𝘀 𝗹𝗶𝗸𝗲 𝘂𝘀, 𝘀𝘁𝗮𝗿𝗶𝗻𝗴 𝘂𝗽 𝗮𝘁 𝗮 𝗹𝗼𝗻𝗲𝗹𝘆 𝗻𝗶𝗴𝗵𝘁 𝘀𝗸𝘆 𝗶𝘀 𝗮 𝗰𝘂𝗿𝘀𝗲.

40:00

𝗪𝗲 𝗮𝗿𝗲 𝗻𝗲𝘄𝗰𝗼𝗺𝗲𝗿𝘀 𝗼𝗻 𝘁𝗵𝗲 𝗰𝗼𝘀𝗺𝗶𝗰 𝘀𝘁𝗮𝗴𝗲, 𝗹𝗼𝗻𝗴𝗶𝗻𝗴 𝗳𝗼𝗿 𝗰𝗼𝗻𝗻𝗲𝗰𝘁𝗶𝗼𝗻 𝗮𝗻𝗱 𝗴𝘂𝗶𝗱𝗮𝗻𝗰𝗲.

40:08

𝗪𝗲 𝗮𝗿𝗲 𝗻𝗲𝘄𝗰𝗼𝗺𝗲𝗿𝘀 𝗼𝗻 𝘁𝗵𝗲 𝗰𝗼𝘀𝗺𝗶𝗰 𝘀𝘁𝗮𝗴𝗲, 𝗹𝗼𝗻𝗴𝗶𝗻𝗴 𝗳𝗼𝗿 𝗰𝗼𝗻𝗻𝗲𝗰𝘁𝗶𝗼𝗻 𝗮𝗻𝗱 𝗴𝘂𝗶𝗱𝗮𝗻𝗰𝗲. 𝗪𝗲 𝗮𝗿𝗲 𝗻𝗲𝘄𝗰𝗼𝗺𝗲𝗿𝘀 𝗼𝗻 𝘁𝗵𝗲 𝗰𝗼𝘀𝗺𝗶𝗰 𝘀𝘁𝗮𝗴𝗲, 𝗹𝗼𝗻𝗴𝗶𝗻𝗴 𝗳𝗼𝗿 𝗰𝗼𝗻𝗻𝗲𝗰𝘁𝗶𝗼𝗻 𝗮𝗻𝗱 𝗴𝘂𝗶𝗱𝗮𝗻𝗰𝗲. 𝗜𝘁 𝗺𝗶𝗴𝗵𝘁 𝘁𝗮𝗸𝗲 𝘁𝗵𝗼𝘂𝘀𝗮𝗻𝗱𝘀 𝗼𝗳 𝘆𝗲𝗮𝗿𝘀 𝘁𝗼 𝗺𝗮𝗸𝗲 𝗮 𝗱𝗶𝘀𝗰𝗼𝘃𝗲𝗿𝘆.

40:17

𝗕𝘂𝘁 𝗮𝘀 𝗹𝗼𝗻𝗴 𝗮𝘀 𝘁𝗵𝗲 𝗺𝘆𝘀𝘁𝗲𝗿𝘆 𝗲𝗻𝗱𝘂𝗿𝗲𝘀, 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗴𝗶𝗮𝗻𝘁𝘀 𝘄𝗶𝗹𝗹 𝗽𝘂𝘀𝗵 𝗼𝗻.

40:24

𝗕𝘂𝘁 𝗮𝘀 𝗹𝗼𝗻𝗴 𝗮𝘀 𝘁𝗵𝗲 𝗺𝘆𝘀𝘁𝗲𝗿𝘆 𝗲𝗻𝗱𝘂𝗿𝗲𝘀, 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗴𝗶𝗮𝗻𝘁𝘀 𝘄𝗶𝗹𝗹 𝗽𝘂𝘀𝗵 𝗼𝗻. 𝗕𝘂𝘁 𝗮𝘀 𝗹𝗼𝗻𝗴 𝗮𝘀 𝘁𝗵𝗲 𝗺𝘆𝘀𝘁𝗲𝗿𝘆 𝗲𝗻𝗱𝘂𝗿𝗲𝘀, 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗴𝗶𝗮𝗻𝘁𝘀 𝘄𝗶𝗹𝗹 𝗽𝘂𝘀𝗵 𝗼𝗻. 𝗕𝘂𝘁 𝗮𝘀 𝗹𝗼𝗻𝗴 𝗮𝘀 𝘁𝗵𝗲 𝗺𝘆𝘀𝘁𝗲𝗿𝘆 𝗲𝗻𝗱𝘂𝗿𝗲𝘀, 𝘁𝗵𝗲 𝘀𝗲𝗮𝗿𝗰𝗵 𝗳𝗼𝗿 𝗴𝗶𝗮𝗻𝘁𝘀 𝘄𝗶𝗹𝗹 𝗽𝘂𝘀𝗵 𝗼𝗻.

40:33

𝗔𝗻𝗱 𝗶𝗳 𝗼𝘂𝗿 𝘀𝗲𝗮𝗿𝗰𝗵 𝗻𝗲𝘃𝗲𝗿 𝗯𝗲𝗮𝗿𝘀 𝗳𝗿𝘂𝗶𝘁?

40:38

𝗧𝗵𝗲𝗻 𝗶𝘁 𝗶𝘀 𝗼𝘂𝗿 𝗰𝗵𝗮𝗻𝗰𝗲‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎ 𝗧𝗵𝗲𝗻 𝗶𝘁 𝗶𝘀 𝗼𝘂𝗿 𝗰𝗵𝗮𝗻𝗰𝗲 𝘁𝗼 𝗯𝗲𝗰𝗼𝗺𝗲 𝘁𝗵𝗲 𝗴𝗶𝗮𝗻𝘁𝘀 𝗼𝘂𝗿𝘀𝗲𝗹𝘃𝗲𝘀.

40:53

𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟰.𝟭𝟯.... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟰.𝟭𝟮.... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟰.𝟭𝟭.... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟰.𝟭𝟬.... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟰.𝟬𝟱.... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟰.𝟬𝟯.... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟰.𝟬𝟮.... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟵𝟵... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟵𝟴... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟵𝟳... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟵𝟲... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟵𝟱... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟵𝟰... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟵𝟯... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟵𝟮... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟵𝟭... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟵𝟬... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟴𝟵... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟴𝟴... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟴𝟳... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟴𝟲... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟴𝟱... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟴𝟰... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟴𝟯... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟴𝟮... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟴𝟭... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟴𝟬... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟳𝟵... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟳𝟴... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟳𝟳... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟳𝟲... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟳𝟱... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟳𝟰... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟳𝟯... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟳𝟮... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟳𝟭... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟳𝟬... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟲𝟵... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟲𝟴... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟲𝟳... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟲𝟲... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟲𝟱... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟲𝟰... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟲𝟯... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟲𝟮... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟲𝟭... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟲𝟬... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟱𝟵... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟱𝟴... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟱𝟳... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟱𝟲... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟱𝟱... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟱𝟰... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟱𝟯... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟱𝟮... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟱𝟭... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟱𝟬... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟰𝟵... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟰𝟴... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟰𝟳... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟰𝟲... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟰𝟱... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟰𝟰... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟰𝟯... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟰𝟮... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟰𝟭... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟰𝟬... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟯𝟵... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟯𝟴... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟯𝟳... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟯𝟲... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟯𝟱... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟯𝟰... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟯𝟯... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟯𝟮... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟯𝟭... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟯𝟬... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟮𝟵... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟮𝟴... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟮𝟳... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟮𝟲... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟮𝟱... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟮𝟰... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟮𝟯... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟮𝟮... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟮𝟭... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟮𝟬... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟭𝟵... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟭𝟴... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟭𝟳... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟭𝟲... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟭𝟱... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟭𝟰... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟭𝟯... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟭𝟮... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟭𝟭... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟭𝟬... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟬𝟵... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟬𝟴... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟬𝟳... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟬𝟲... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟬𝟱... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟬𝟰... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟬𝟯... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟬𝟮... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟬𝟭... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟯.𝟬𝟬... 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟵𝟵.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟵𝟴.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟵𝟳.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟵𝟲.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟵𝟱.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟵𝟰.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟵𝟯.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟵𝟮.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟵𝟭.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟵𝟬.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟴𝟵.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟴𝟴.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟴𝟳.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟴𝟲.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟴𝟱.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟴𝟰.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟴𝟯.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟴𝟮.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟴𝟭.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟴𝟬.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟳𝟵.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟳𝟴.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟳𝟳.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟳𝟲.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟳𝟱.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟳𝟰.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟳𝟯.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟳𝟮.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟳𝟭.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟳𝟬.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟲𝟵.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟲𝟴.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟲𝟳.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟲𝟲.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟲𝟱.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟲𝟰.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟲𝟯.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟲𝟮.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟲𝟭.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟲𝟬.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟱𝟵.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟱𝟴.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟱𝟳.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟱𝟲.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟱𝟱.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟱𝟰.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟱𝟯.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟱𝟮.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟱𝟭.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟱𝟬.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟰𝟵.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟰𝟴.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟰𝟳.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟰𝟲.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟰𝟱.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟰𝟰.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟰𝟯.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟰𝟮.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟰𝟭.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟰𝟬.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟯𝟵.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟯𝟴.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟯𝟳.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟯𝟲.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟯𝟱.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟯𝟰.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟯𝟯.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟯𝟮.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟯𝟭.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟯𝟬.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟮𝟵.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟮𝟴.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟮𝟳.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟮𝟲.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟮𝟱.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟮𝟰.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟮𝟯.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟮𝟮.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟮𝟭.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟮𝟬.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟭𝟵.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟭𝟴.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟭𝟳.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟭𝟲.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟭𝟱.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟭𝟰.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟭𝟯.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟭𝟮.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟭𝟭.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟭𝟬.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟬𝟵.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟬𝟴.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟬𝟳.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟬𝟲.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟬𝟱.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟬𝟰.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟬𝟯.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟬𝟮.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟬𝟭.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟮.𝟬𝟬.. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟵𝟵. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟵𝟴. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟵𝟳. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟵𝟲. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟵𝟱. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟵𝟰. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟵𝟯. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟵𝟮. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟵𝟭. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟵𝟬. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟴𝟵. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟴𝟴. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟴𝟳. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟴𝟲. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟴𝟱. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟴𝟰. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟴𝟯. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟴𝟮. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟴𝟭. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟴𝟬. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟳𝟵. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟳𝟴. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟳𝟳. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟳𝟲. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟳𝟱. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟳𝟰. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟳𝟯 . 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟳𝟮. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟳𝟭. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟳𝟬. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟲𝟵. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟲𝟴. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟲𝟳. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟲𝟲. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟲𝟱. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟲𝟰. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟲𝟯. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟲𝟮. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟲𝟭. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟲𝟬. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟱𝟵. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟱𝟴. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟱𝟳. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟱𝟲. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟱𝟱. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟱𝟰. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟱𝟯 . 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟱𝟮. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟱𝟭. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟱𝟬. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟰𝟵. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟰𝟴. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟰𝟳. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟰𝟲. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟰𝟱. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟰𝟰. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟰𝟯. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟰𝟮. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟰𝟭. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟰𝟬. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟯𝟵. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟯𝟴. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟯𝟳. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟯𝟲. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟯𝟱. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟯𝟰. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟯𝟯. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟯𝟮. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟯𝟭. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟯𝟬. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟮𝟵. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟮𝟴. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟮𝟳. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟮𝟲. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟮𝟱. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟮𝟰. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟮𝟯. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟮𝟮. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟮𝟭. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟮𝟬. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟭𝟵. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟭𝟴. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟭𝟳. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟭𝟲. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟭𝟱. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟭𝟰. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟭𝟯. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟭𝟮. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟭𝟭. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟭𝟬. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟬𝟵. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟬𝟴. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟬𝟳. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟬𝟲. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟬𝟱. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟬𝟰. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟬𝟯. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟬𝟮. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟬𝟭. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟭.𝟬𝟬. 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟵𝟵 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟵𝟴 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟵𝟳 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟵𝟲 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟵𝟱 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟵𝟰 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟵𝟯 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟵𝟮 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟵𝟭 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟵𝟬 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟴𝟵 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟴𝟴 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟴𝟳 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟴𝟲 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟴𝟱 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟴𝟰 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟴𝟯 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟴𝟮 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟴𝟭 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟴𝟬 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟳𝟵 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟳𝟴 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟳𝟳 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟳𝟲 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟳𝟱 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟳𝟰 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟳𝟯 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟳𝟮 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟳𝟭 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟳𝟬 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟲𝟵 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟲𝟴 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟲𝟳 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟲𝟲 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟲𝟱 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟲𝟰 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟲𝟯 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟲𝟮 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟲𝟭 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟲𝟬 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟱𝟵 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟱𝟴 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟱𝟳 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟱𝟲 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟱𝟱 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟱𝟰 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟱𝟯 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟱𝟮 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟱𝟭 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟱𝟬 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟰𝟵 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟰𝟴 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟰𝟳 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟰𝟲 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟰𝟱 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟰𝟰 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟰𝟯 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟰𝟮 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟰𝟭 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟰𝟬 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟯𝟵 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟯𝟴 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟯𝟳 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟯𝟲 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟯𝟱 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟯𝟰 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟯𝟯 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟯𝟮 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟯𝟭 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟯𝟬 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟮𝟵 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟮𝟴 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟮𝟳 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟮𝟲 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟮𝟱 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟮𝟰 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟮𝟯 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟮𝟮 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟮𝟭 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟮𝟬 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟭𝟵 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟭𝟴 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟭𝟳 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟭𝟲 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟭𝟱 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟭𝟰 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟭𝟯 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟭𝟮 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟭𝟭 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟭𝟬 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟬𝟵 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟬𝟴 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟬𝟳 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟬𝟲 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟬𝟱 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟬𝟰 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟬𝟯 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟬𝟮 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟬𝟭 𝗲𝗻𝗱 𝗰𝗿𝗲𝗱𝗶𝘁𝘀 𝗶𝗻 𝟬.𝟬𝟬

40:58

𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 r| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 re| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 rem| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 rema| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remas| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remast| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remaste| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remaster| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastere| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered | ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered c| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered ca| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered cap| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered capt| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered capti| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captio| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered caption| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions | ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions c| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions co| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions con| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions cont| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contr| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contri| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contrib| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contribu| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contribut| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributo| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor h| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor ha| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor han| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor hand| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handc| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcr| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcra| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcraf| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcraft| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafte| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted | ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted b| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by:| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by:| ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: v| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vr| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrg| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgt| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgti| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtic| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics | 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics w| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics wa| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics war| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics ware| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics wareh| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehou| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse | 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTu| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | i| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | inst| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | insta: @| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | insta: @a.16w| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | insta: @a.16waysJac| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | insta: @a.16\waysJackin| 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | insta: @a.16waysJackinn_ | 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | insta: @a.16waysJackinn_ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | insta: @a.16waysJackinn_ | 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 remastered captions contributor handcrafted by: vrgtics warehouse on YouTube | insta: @a.16waysJackinn_ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 ⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷ ⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷⌷ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 ‏‏‎ ‎ 𝗛𝗔𝗡𝗗 𝗖𝗥𝗔𝗙𝗧𝗘𝗗 𝗕𝗬 𝗠𝗘𝗟𝗢𝗗𝗬𝗦𝗛𝗘𝗘𝗣 ‏‏‎ ‎ ‏‏‎ ‎

41:03

‏‏‎ ‎ ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ꜱᴜᴘᴘᴏʀᴛᴇᴅ ʙʏ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ‏‏‎ ‎ 𝗣𝗿𝗼𝘁𝗼𝗰𝗼𝗹 𝗟𝗮𝗯𝘀 ‏‏‎ ‎ ɴᴀʀʀᴀᴛᴇᴅ ʙʏ ‏‏‎ ‎ ɴᴀʀʀᴀᴛᴇᴅ ʙʏ Will Crowley

41:08

ɴᴀʀʀᴀᴛᴇᴅ ʙʏ Will Crowley ‏‏‎ ‎ Will Crowley ‏‏‎ ‎ ᴠɪꜱᴜᴀʟꜱ, ᴍᴜꜱɪᴄ, ꜱᴏᴜɴᴅ, & ꜱᴛᴏʀʏ ʙʏ ‏‏‎ ‎ ᴠɪꜱᴜᴀʟꜱ, ᴍᴜꜱɪᴄ, ꜱᴏᴜɴᴅ, & ꜱᴛᴏʀʏ ʙʏ ‏‏‎ ‎ ‏‏‎ ‎ ᴠɪꜱᴜᴀʟꜱ, ᴍᴜꜱɪᴄ, ꜱᴏᴜɴᴅ, & ꜱᴛᴏʀʏ ʙʏ melodysheep (John D. Boswell) ᴠɪꜱᴜᴀʟꜱ, ᴍᴜꜱɪᴄ, ꜱᴏᴜɴᴅ, & ꜱᴛᴏʀʏ ʙʏ melodysheep (John D. Boswell) ‏‏‎ ‎ melodysheep (John D. Boswell) ‏‏‎ ‎ ᴀᴅᴅɪᴛɪᴏɴᴀʟ ᴠɪꜱᴜᴀʟꜱ ʙʏ ‏‏‎ ‎ ᴀᴅᴅɪᴛɪᴏɴᴀʟ ᴠɪꜱᴜᴀʟꜱ ʙʏ ‏‏‎ ‎ ᴀᴅᴅɪᴛɪᴏɴᴀʟ ᴠɪꜱᴜᴀʟꜱ ʙʏ ‏‏‎ ‎ Unknown Dino ‏‏‎ ‎ Unknown Dino Julius Horsthuis

41:14

Unknown Dino Julius Horsthuis Samuel King Julius Horsthuis Samuel King Eren Arik Samuel King Eren Arik CGHadi Eren Arik CGHadi ESO / M. Kornmesser CGHadi ESO / M. Kornmesser Jack Emmens ESO / M. Kornmesser Jack Emmens ‏‏‎ ‎ Jack Emmens ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ 3ᴅ ᴍᴏᴅᴇʟᴇʀꜱ ‏‏‎ ‎ 3ᴅ ᴍᴏᴅᴇʟᴇʀꜱ ‏‏‎ ‎

41:19

3ᴅ ᴍᴏᴅᴇʟᴇʀꜱ ‏‏‎ ‎ Adrian Bobb ‏‏‎ ‎ Adrian Bobb Igor Puskaric Adrian Bobb Igor Puskaric Unknown Dino Igor Puskaric Unknown Dino Alan Raynaud Unknown Dino Alan Raynaud Eren Arik Alan Raynaud Eren Arik ‏‏‎ ‎ Eren Arik ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛᴇʀ ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛᴇʀ ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛᴇʀ ‏‏‎ ‎ Cruz Abalos

41:24

‏‏‎ ‎ Cruz Abalos Juan Benet Cruz Abalos Juan Benet Matthew Brown Juan Benet Matthew Brown Adam Franke - WooDawg Matthew Brown Adam Franke - WooDawg Zeus Kontoyannis Adam Franke - WooDawg Zeus Kontoyannis Negentropyy Zeus Kontoyannis Negentropyy Leon Red Negentropyy Leon Red Morrison Waud Leon Red Morrison Waud Whyrusleeping

41:30

Morrison Waud Whyrusleeping ‏‏‎ ‎ Whyrusleeping ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ꜱᴘᴇᴄɪᴀʟ ᴛʜᴀɴᴋꜱ ᴛᴏ ‏‏‎ ‎ ꜱᴘᴇᴄɪᴀʟ ᴛʜᴀɴᴋꜱ ᴛᴏ ‏‏‎ ‎ ꜱᴘᴇᴄɪᴀʟ ᴛʜᴀɴᴋꜱ ᴛᴏ ‏‏‎ ‎ Franck Marchis ‏‏‎ ‎ Franck Marchis Clément Vidal Franck Marchis Clément Vidal Julius Horsthuis Clément Vidal Julius Horsthuis Holly Boswell Julius Horsthuis Holly Boswell melodysheep Patreon Supporters

41:35

Holly Boswell melodysheep Patreon Supporters ‏‏‎ ‎ melodysheep Patreon Supporters ‏‏‎ ‎ ᴀᴅᴅɪᴛɪᴏɴᴀʟ ʀᴇꜱᴇᴀʀᴄʜ ʙʏ ‏‏‎ ‎ ᴀᴅᴅɪᴛɪᴏɴᴀʟ ʀᴇꜱᴇᴀʀᴄʜ ʙʏ ‏‏‎ ‎ ᴀᴅᴅɪᴛɪᴏɴᴀʟ ʀᴇꜱᴇᴀʀᴄʜ ʙʏ ‏‏‎ ‎ John Morrison ‏‏‎ ‎ John Morrison ‏‏‎ ‎ John Morrison ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛ ᴛʜᴇ ᴀʀᴛʟɪꜱᴛ ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛ ᴛʜᴇ ᴀʀᴛʟɪꜱᴛ ‏‏‎ ‎ ‏‏‎ ‎ ꜱᴜᴘᴘᴏʀᴛ ᴛʜᴇ ᴀʀᴛʟɪꜱᴛ 𝗽𝗮𝘁𝗿𝗲𝗼𝗻.𝗰𝗼𝗺/𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 ꜱᴜᴘᴘᴏʀᴛ ᴛʜᴇ ᴀʀᴛʟɪꜱᴛ 𝗽𝗮𝘁𝗿𝗲𝗼𝗻.𝗰𝗼𝗺/𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 ‏‏‎ ‎

41:40

𝗽𝗮𝘁𝗿𝗲𝗼𝗻.𝗰𝗼𝗺/𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽 ‏‏‎ ‎ 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽.𝗰𝗼𝗺 ‏‏‎ ‎ 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽.𝗰𝗼𝗺 Instagram: @melodysheep_ 𝗺𝗲𝗹𝗼𝗱𝘆𝘀𝗵𝗲𝗲𝗽.𝗰𝗼𝗺 Instagram: @melodysheep_ Twitter: @musicalscience Instagram: @melodysheep_ Twitter: @musicalscience ‏‏‎ ‎ Twitter: @musicalscience ‏‏‎ ‎ ᵃⁿ ‏‏‎ ‎ ᵃⁿ ‏‏‎ ‎ ᵃⁿ ‏‏‎ ‎ 𝗔𝗠𝗕𝗘𝗥 𝗠𝗢𝗨𝗡𝗧𝗔𝗜𝗡 𝗦𝗧𝗨𝗗𝗜𝗢𝗦 ‏‏‎ ‎ 𝗔𝗠𝗕𝗘𝗥 𝗠𝗢𝗨𝗡𝗧𝗔𝗜𝗡 𝗦𝗧𝗨𝗗𝗜𝗢𝗦 ᴘʀᴏᴅᴜᴄᴛɪᴏɴ

41:46

𝗔𝗠𝗕𝗘𝗥 𝗠𝗢𝗨𝗡𝗧𝗔𝗜𝗡 𝗦𝗧𝗨𝗗𝗜𝗢𝗦 ᴘʀᴏᴅᴜᴄᴛɪᴏɴ ‏‏‎ ‎ ᴘʀᴏᴅᴜᴄᴛɪᴏɴ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ ‏‏‎ ‎ For Rocky ‏‏‎ ‎ For Rocky For Rocky

41:55

ꜱᴏᴜɴᴅᴛʀᴀᴄᴋ ᴄᴏᴍɪɴɢ ᴛᴏ ᴀʟʟ ᴍᴀᴊᴏʀ ᴍᴜꜱɪᴄ ᴘʟᴀᴛꜰᴏʀᴍꜱ L‏‏‎ ‎I‏‏‎ ‎F‏‏‎ ‎E

42:00

L‏‏‎ ‎I‏‏‎ ‎F‏‏‎ ‎E‏‏‎‏‏‎ ‎‏‏‎‎ ‎ B‏‏‎ ‎E‏‏‎ ‎Y‏‏‎ ‎O‏‏‎ ‎N‏‏‎ ‎D

42:07

[0] ᵗʰⁱˢ ⁱˢ ᵇʳᵃᶜᵏᵉᵗ ʳᵉᶠᵉʳᵉⁿᶜᵉ ᵐᵃʳᵏ ⁱⁿᶜˡᵘᵈⁱⁿᵍ ⁿᵘᵐᵇᵉʳˢ ʷʰⁱᶜʰ ᵃᵖᵖᵉᵃʳᵉᵈ ᵈᵉᵖᵉⁿᵈ ᵉᵛᵉⁿᵗ ᶠᵒʳ ᵐᵒʳᵉ ⁱⁿᶠᵒʳᵐᵃᵗⁱᵒⁿ ᵃⁿᵈ ᶜᵃᵖᵗⁱᵒⁿⁱˢᵗ ˢᵖᵉᵃᵏˢ [1] ᴸⁱᶠᵉ ᴮᵉʸᵒⁿᵈ ³ ᴵⁿ ˢᵉᵃʳᶜʰ ᵒᶠ ᴳⁱᵃⁿᵗˢ ˢᶜʳⁱᵖᵗ 𝗯𝗶𝘁.𝗹𝘆/𝟯𝘇𝘁𝗱𝗳𝗤𝟱 [2] ᵗʰᵉ ᵗʰⁱⁿᵍ ˢʰᵒᵘˡᵈⁿ'ᵗ ᵖᵘᵗ ᵇᵉˡᵒʷ ᵗʰᵉ ᵃᵗᵐᵒˢᵖʰᵉʳᵉ 𝗾𝘂𝗼𝗿𝗮.𝗰𝗼𝗺/𝗪𝗵𝗮𝘁-𝗶𝗳-𝘆𝗼𝘂-𝗽𝗼𝗶𝗻𝘁𝗲𝗱-𝗮-𝟱𝟬𝟬-𝘆𝗼𝘁𝘁𝗮𝘄𝗮𝘁𝘁-𝗹𝗮𝘀𝗲𝗿-𝗮𝘁-𝘁𝗵𝗲-𝗠𝗼𝗼𝗻 [3] ᶜᵃⁿ ᵃᶜʰⁱᵉᵛᵉ ˢᵘᶜʰ ᵉⁿᵉʳᵍʸ ᵘˢⁱⁿᵍ ᵖʳᵒᵇᵃᵇˡʸ ⁿᵒᵗ ˡᵃˢᵉʳ ᵇᵘᵗ ᵖˡᵃˢᵐᵃ ᵗᵒ ᶠⁱʳⁱⁿᵍ ᵗʰⁱˢ ᵗᵘʳʳᵉᵗ ᵐⁱᵍʰᵗ ⁱˢⁿᵗ ᴷᵃʳᵈᵃˢʰᵉᵛ ˢᶜᵃˡᵉ ᶜⁱᵛⁱˡⁱᶻᵃᵗⁱᵒⁿ ᵀʸᵖᵉ ᴼⁿᵉ 𝘀𝘁𝗮𝗿𝘄𝗮𝗿𝘀.𝗳𝗮𝗻𝗱𝗼𝗺.𝗰𝗼𝗺/𝘄𝗶𝗸𝗶/𝗣𝗹𝗮𝗻𝗲𝘁𝗮𝗿𝘆_𝘀𝗵𝗶𝗲𝗹𝗱/𝗟𝗲𝗴𝗲𝗻𝗱𝘀 [4] 𝗽𝗹𝗮𝗻𝗲𝘁𝗽𝗹𝗮𝗻𝗲𝘁.𝗻𝗲𝘁/𝟮𝟬𝟭𝟴/𝟬𝟱/𝟯𝟬/𝘁𝗵𝗲-𝗯𝗹𝗮𝗰𝗸-𝗵𝗼𝗹𝗲-𝘂𝗹𝘁𝗶𝗺𝗮𝘁𝗲-𝘀𝗼𝗹𝗮𝗿-𝘀𝘆𝘀𝘁𝗲𝗺

42:34

{The End of Captions} {Thanks For Activated Captions}